Response of Bacterial Community Structure in the Bulk Soil and Rice Straw Residues under Different Crop Rotation Systems

Table 1

The primer pairs F984-GC and R1378 for PCR amplification in this study.

Primer	Target	Sequence (5^′–3^′)	Reference
F984-GC	Bacteria—16S rRNA	GC.-AACGCGAAGAACCTTAC	Heuer et al. [31]
R1378	Bacteria—16S rRNA	CGGTGTGTACAAGGCCCGGGAACG	Heuer et al. [31].

F984 contained GC clamp: CGC-CCG-GGG-CGC-GCC-CCG-GGC-GGG-GCG-GGG-GCA-CGG-GGGG at the 5^′ site.