Research Article
Response of Bacterial Community Structure in the Bulk Soil and Rice Straw Residues under Different Crop Rotation Systems
Table 1
The primer pairs F984-GC and R1378 for PCR amplification in this study.
| | Primer | Target | Sequence (5′–3′) | Reference |
| | F984-GC | Bacteria—16S rRNA | GC.-AACGCGAAGAACCTTAC | Heuer et al. [31] | | R1378 | Bacteria—16S rRNA | CGGTGTGTACAAGGCCCGGGAACG | Heuer et al. [31]. |
|
|
F984 contained GC clamp: CGC-CCG-GGG-CGC-GCC-CCG-GGC-GGG-GCG-GGG-GCA-CGG-GGGG at the 5 ′ site. |