Abstract
Liver cirrhosis is the final stage of chronic liver disease and can be life-threatening. Despite extensive studies on its treatment, a standard therapy is yet to be developed. Considering the complex mechanism of fibrogenic and fibrolytic processes in liver cirrhosis, combined therapy may have clinically significant effects on cirrhotic livers. In this study, we used thioacetamide (TAA) administration and matrix metalloproteinase-13 (MMP13) gene delivery to induce extracellular matrix generation and degradation in rats. The aim of this study was to determine whether hydrodynamics-based gene delivery of MMP13 to cirrhotic liver has regressive and suppressive effects on fibrogenesis. MMP13-encoding plasmids were hydrodynamically delivered to TAA-induced cirrhotic livers, and intravascular pressure was monitored. Therapeutic effect with and without continuous TAA exposure was assessed 8 weeks after the gene delivery. Test results indicated successful gene delivery and gene expression in the cirrhotic livers. Furthermore, microscopic imaging showed that MMP13 delivery resulted in significant degradation of fibrotic areas. Quantitative analysis of hydroxyproline content supported the microscopic findings. These results suggest that transgene delivery of MMP13 can be a promising candidate to treat liver fibrosis and that hydrodynamics-based gene delivery can be a good option for delivery of MMP13 to cirrhotic livers.
1. Introduction
Liver cirrhosis is the final stage of liver fibrosis, which is caused by chronic liver injury [1, 2]. Although several studies on the treatment of liver fibrosis have been conducted, antifibrotic treatment remains an unmet medical need for liver cirrhosis, because the mechanisms of fibrosis are complex [2]. Treatment approaches for liver fibrosis include control of underlying liver disease, suppression of hepatic stellate cell activity, and degradation of the pathological extracellular matrix (ECM).
In our previous study, we demonstrated that the hydrodynamic gene delivery of matrix metalloproteinase-13 (MMP13) gene [3], which is a collagenase secreted by various cells and capable of degrading the ECM, into the hepatocytes prevented the progression of fibrosis in the rat liver fibrosis model. Based on the above-mentioned preliminary results, the aim of this study was to investigate whether hydrodynamics-based MMP13 gene therapy in a thioacetamide- (TAA-) induced rat liver fibrosis model can be a candidate for fibrolytic therapy and show regression and suppression in advanced stage liver fibrosis.
2. Materials and Methods
2.1. Plasmid and Animal
MMP13-encoding plasmids (pBGI-MMP13) were prepared as described in our previous study [3]. All animal experiments were conducted in full compliance with the relevant regulations and were approved by the Institutional Animal Care and Use Committee of Niigata University (SA00263). Wistar rats (female rats weighing 200–230 g) were purchased from Charles River Laboratories Japan (Yokohama, Kanagawa, Japan). Figure 1(a) summarizes the animal model used in this study. The cirrhotic liver was developed by feeding TAA solution to rats for the first 12 weeks of the study, which was based on body weight changes (Figure 1(b)). The concentration of the TAA solution was adjusted once a week using the method described in a previous study [4] (Figure 1(c)). In brief, TAA was dissolved in drinking water, its concentration was uniformly set at 0.03% from day 1 to day 7, and appropriate adjustments were made every week based on the weight changes of individual rats. After the initial TAA exposure, rats that were fed TAA solution for 12 weeks (T12w rats) were euthanized and their livers were used to obtain baseline data. The other rats were divided into four groups, namely, TMO, TOO, TMT, and TOT. Rats in the TMO and TMT groups underwent hydrodynamics-based gene delivery of pBGI-MMP13. Rats in the TOO and TOT groups underwent a sham procedure, which has been summarized in Figure 1(a). Following a 1-week period of recuperation, rats in the TMT and TOT groups were again fed TAA solution of appropriate concentration. In contrast, rats in the TMO and TOO groups were fed normal water. The liver-targeted hydrodynamics-based gene delivery of pBGI-MMP13 (10 μg/ml in saline) to rats was performed as described in our previous study [3].

(a)

(b)

(c)
2.2. Detection of Plasmids and mRNA in Cirrhotic Liver
Whole DNA from the liver was eluted using the DNeasy Blood & Tissue Kit (Qiagen, Hilde, Germany), and PCR was performed using primers for AmpR sequence (F primer: tccttgagagttttcgcccc; R primer: cagtgctgcaatgataccgc) and PrimeSTAR Max DNA Polymerase (Takara, Shiga, Japan) to detect pBGI-MMP13. Amplification was performed as follows: 98°C for 2 min, 35 cycles of 98°C for 10 sec, 61°C for 5 sec, 72°C for 10 sec, and 72°C for 30 sec. For mRNA detection, whole RNA was collected using RNeasy Mini Kit and RNase-Free DNase Set (Qiagen, Hilde, Germany). QuantiTect SYBR Green RT-PCR Kit and QuantiTect Primer Assays for MMP13 and Gapdh (Qiagen, Hilde, Germany) were used for mRNA detection. One-step RT-PCR was performed as follows: 50°C for 30 min and 95°C for 15 min, followed by 40 cycles of 94°C for 15 sec, 55°C for 30 sec, and 72°C for 30 sec. The band shades of the AmpR and MMP13 PCR products were represented as the peak, quantified, and compared using the MultiNA Viewer software.
2.3. Measurement of Serum MMP13 Concentration
Blood samples were collected from the tail vein 2 weeks after gene delivery, and serum MMP13 concentration was determined by performing enzyme-linked immunosorbent assay using the Human MMP13 ELISA Kit (ELH-MMP13; RayBiotech Norcross, GA, USA).
2.4. Sirius Red Staining
Liver samples were collected at 12 or 20 weeks of the study period and fixed in 10% formalin and embedded in paraffin, and then, sections 10 μm in thickness were made. Sirius red staining was performed, and the fibrotic area was calculated using ImageJ (version 2.0.0; National Institutes of Health) as described in a previous study [5].
2.5. Quantification of Hydroxyproline Content
Hydroxyproline content in each liver lobe was determined using the QuickZyme Hydroxyproline Assay Kit (QZBHYPRO2; QuickZyme Biosciences B.V., Netherlands).
2.6. Statistical Analysis
Data from histological and biochemical analyses were statistically evaluated using Mann–Whitney test.
3. Results
3.1. Successful Gene Delivery of pBGI-MMP13 into Cirrhotic Liver
Figure 1(a) depicts a summary of the development of animal models, and with details are provided in Materials and Methods. Briefly, TAA-induced rat liver fibrosis was developed by TAA feeding based on body weight changes (Figure 1(b)) and adjusting TAA concentration (Figure 1(c)). The five groups of rats used in the study were named as follows: T12w, fed TAA for 12 weeks; TOO, fed TAA for 12 weeks, sham procedure, following water feeding; TMO, fed TAA for 12 weeks, MMP13 delivery, following water feeding; TOT, fed TAA for 12 weeks, sham procedure, following TAA feeding; and TMT, fed TAA for 12 weeks, MMP13 delivery, following TAA feeding (Figure 1(a)). Liver-specific hydrodynamics-based gene delivery was performed in the animal models (Figure 1) via the inferior vena cava with intravascular pressure monitoring as described in an earlier study [6]. A representative time–pressure curve is shown in Figure 2(a). Portal vein (PV) pressure peaked at baseline plus 30 mmHg within 10 sec, and the injection volume was about 9 ml. To demonstrate successful delivery of pBGI-MMP13, whole DNA was extracted from pieces of the cirrhotic liver 8 weeks after the gene delivery. The results of polymerase chain reaction (PCR) (Figures 2(b) and 2(c)) show expected AmpR bands in the TMO (lane B) and TMT (lane D) groups, and the results of reverse transcription-polymerase chain reaction (RT-PCR) (Figures 2(d)–2(f)) show the MMP13 band in the TMO (lane H) and TMT (lane L) groups. Figure 2(g) shows the level of serum MMP13, 2 weeks after the gene delivery. The mean MMP13 concentrations in the TMO, TOO, TMT, and TOT groups were 65.1 ng/ml, 12.1 ng/ml, 42.2 ng/ml, and 9.6 ng/ml, respectively. These results indicate that hydrodynamics-based gene delivery of pBGI-MMP13 into the cirrhotic liver was successfully performed and that MMP13 expression in the liver resulted in the secretion of MMP13 in the serum.

(a)

(b)

(c)

(d)

(e)

(f)

(g)
3.2. Regressive Effect on Liver Fibrosis in the TMO Group
Sirius red staining of TMO and TOO livers revealed fibrotic areas of 2.4% and 7.0%. Compared to the TOO and T12w groups, the TMO group had significantly decreased fibrotic area (, Figures 3(a) and 3(b)). Hydroxyproline also supported the evidence (, Figure 3(c)). The above results suggest that the hydrodynamics-based MMP13 gene delivery to cirrhotic liver improved fibrotic change without continuous TAA exposure.

(a)

(b)

(c)

(d)

(e)

(f)
3.3. Suppressive Effect on Liver Fibrosis in the TMT Group
After 12 plus 7 weeks of TAA exposure, rats of the TMT and TOT groups were euthanized. Fibrotic liver areas in the TMT and TOT groups increased to 8.7% and 14.8%. Although rats in the TMT and TOT groups developed more fibrotic tissue than rats in the T12w group (4.4%, ), fibrotic progression in the TMT group was significantly suppressed compared to that in the TOT group (, Figures 3(d) and 3(e)). Analysis of hydroxyproline content in the fibrotic liver also supported the results (Figure 3(f)). These results suggest that the hydrodynamics-based MMP13 gene delivery to the cirrhotic liver suppressed fibrotic progression under TAA exposure.
4. Discussion
The applicability of gene therapy has increased with the availability of genetic information regarding various diseases [7], including liver fibrosis [8]. In this study, we demonstrated the effect of MMP13 gene therapy on liver fibrosis. MMP13, also known as collagenase 3, is a secreted protein [9] that is reported to be produced by hepatic stellate cells during the recovery phase of fibrosis [10] and by the Kupffer cells [11]. In addition to the activity of collagenase 3, the induction of MMP2, MMP9, and hepatocyte growth factor contributes to the improvement of liver fibrosis induced by CCl4 and to liver regeneration [12]. According to a previous study on TAA-induced liver fibrosis, the negative regulation of Mmp13 to Tgfβ3 may be involved in the mechanisms underlying the antifibrotic effects of the treatment [13]. It is therefore logical to focus on MMP13 gene delivery for potential gene therapy of liver fibrosis. Based on the above-mentioned reports, in our previous study, we showed the preventive effect of MMP13 against rat bile duct ligation liver fibrosis model [3] using a hydrodynamics-based gene delivery [14–17]. The MMP13 expression was sustained for 70 days after the gene delivery to a rat with a fibrotic liver [3]. In addition, the efficacy of the procedure was dependent on the amount of fibrotic tissue [18]. Based on these results, we evaluated whether hydrodynamics-based gene delivery of MMP13 into advanced fibrotic livers with appropriate parameters could regress or suppress liver fibrosis. Indeed, MMP13 was successfully delivered to hepatocytes in the fibrotic liver, and it reduced the ECM and suppressed further fibrogenesis. Although there is no statistical difference in plasmid DNA volume and MMP13 expression between TMO and TMT (Figures 2(c), 2(e), and 2(f)), the tendency of lower MMP13 expression in TMT could be due to the subsequent TAA administration, which caused damage to the transgene-delivered hepatocytes. Thus, this is the first study to show the efficacy of hydrodynamics-based gene delivery of MMP13 to cirrhotic livers and its antifibrotic therapeutic effect on the livers. MMP13 can be a promising candidate for clinical application. Simple and effective hydrodynamics-based gene delivery of MMP13 has the potential to become a promising option of gene therapy for cirrhotic livers.
This study has limitations. Firstly, the results are entirely based on an in vivo study with one animal model and lack the molecular mechanism analyses. Secondly, the biological safety of MMP13 overexpression was not fully investigated. Therefore, further studies using other fibrosis models, focusing on molecular mechanisms [19, 20], and in vitro studies are essential.
5. Conclusion
In conclusion, liver-specific hydrodynamics-based gene delivery of MMP13 showed therapeutic effects on fibrotic livers. Thus, MMP13 gene therapy could be a promising candidate for the treatment of liver fibrosis, and hydrodynamics-based gene delivery may be considered an option for the delivery of therapeutic genes to cirrhotic livers (Figure 4).

Data Availability
The data used to support the findings of this study are included within the article.
Conflicts of Interest
The authors have no conflict of interest to declare.
Authors’ Contributions
Takeshi Yokoo and Kenya Kamimura designed the study, interpreted the data, and wrote the manuscript. Takeshi Yokoo, Moeno Sugita, Osamu Shibata, and Ryosuke Nozawa prepared and fed TAA. Takeshi Yokoo collected and analyzed the data. Yuji Kobayashi, Hiroyuki Abe, and Shuji Terai supervised the scientific accuracy of the intellectual content. Hiromi Miura and Masato Ohtsuka generated pBGI-MMP13.
Acknowledgments
The authors thank Takao Tsuchida of the Division of Gastroenterology and Hepatology, Niigata University, for excellent assistance in histological analysis. The authors also thank Nobuyoshi Fujisawa, Toshikuni Sasaoka, and all staff members of the Division of Laboratory Animal Resources, Niigata University. The authors’ laboratory research was partly supported by the Grant-in-Aid for Scientific Research from the Japanese Society for the Promotion of Sciences (16K19333) to Takeshi Yokoo and (20K08379 and 23H02763) to Kenya Kamimura and by a grant from the Japan Agency for Medical Research and Development (JP22fk0310508s and JP23fk0310508s) to Terai S and Kamimura K.