Evaluation of the Cytotoxicity of Aqueous Extract and Oleo-Essential Oil of Dorema ammoniacum Plant Oleo-Gum Resin in Some Human Cancer Cell Lines

Table 1

Primers and probes of caspase-9.

Oligo name	Seq. (5-3)	Molecular weight	OD^1 (1000 μM)	Nmol^2	TM^3	GC%^4
CAs3forward	GTTTGAGGACCTTCGACCAGCT	6726.4	2.3	11.28	62.12	54.55
CAs3reverse	CAACGTACCAGGAGCCACTCTT	6664.3	4.4	21.79	62.12	54.55

¹Oligonucleotide absorbance at 260 nm. ²Amount of nucleotide based on nM. ³Temperature of melting point of nucleotide. ⁴Percentage of GC.