Research Article
Changes in the Neuropeptide Y mRNA Expression in Oncorhynchus mykiss at Different Feeding Frequencies
Table 2
The sequence and characteristics of primer used in real-time PCR.
| | Gene | Primer name | Primer sequence | Tm (°C) | Reference |
| | NPY | F | CTCGTCTGGACCTTTATATGC | 57 | NM_001124266 | | NPY | R | GTTCATCATATCTGGACTGTG | 57 | NM_001124266 | | B-actin | F | GATGGGCCAGAAAGACAGCTA | 57 | AJ438158 | | B-actin | R | TCGTCCCAGTTGGTGACGAT | 57 | AJ438158 |
|
|
