Research Article
Antiaging and Antioxidant Bioactivities of Asteraceae Plant Fractions on the Cellular Functions of the Yeast Schizosaccharomyces pombe
Table 2
Primer pairs used in the analysis of gene expression by using qRT-PCR.
| Targeted genes | Primer sequence |
| Reference gene (act1+) | Forward (F) | 5′ CGGTCGTGACTTGACTGACT 3′ | Reverse (R) | 5′ ATTTCACGTTCGGCGGTAGT 3′ |
| Transcriptional factor Pap1 (pap1+) | Forward (F) | 5′ TGGATGGCGATGTTAAGCCT 3′ | Reverse (R) | 5′ GCAGCACGGTTTTGAGCTTT 3′ |
| Superoxide dismutase 2 (sod2+) | Forward (F) | 5′ ATTTGGAGGGAGAGGTTGCC 3′ | Reverse (R) | 5′ GATTGATGTGACCACCGCCA 3′ |
| Catalase (ctt1+) | Forward (F) | 5′ TCGTGACGGCCCTATGAATG 3′ | Reverse (R) | 5′ AGCAAGTGGTCGGATTGAGG 3′ |
|
|