Research Article
Development and Validation of Rapid Colorimetric Reverse Transcription Loop-Mediated Isothermal Amplification for Detection of Rift Valley Fever Virus
Table 2
Details of the RT-LAMP Glycoprotein gene primer set for rapid and real-time detection of RVFV.
| | Primer’s name and description | Position on the genomea | Length of the oligonucleotide (bp) | Oligonucleotide sequence |
| | F3 | 2584–2602 | 19 | GGGTGCATAAACTCACTCT | | B3 | 2775–2794 | 20 | CGAGGAATTTCTGAGAATGG | | FIP (F1c + F2) | 2667–2635 2615–2652 | 42 | GCTGACTGAACCCCAGTTTGTCTTTGATGGCTCTGTTTCAAC | | BIP (B1c + B2) | 2696–2715 | 40 | GGACGCAGAGGGCATTTCAGCATCAACAATTGCATACCCT | | 2753–2773 | | LF | 2636–2656 | 21 | GATGATGCTCCCAAGTCTACT | | LB | 2731–2752 | 22 | CTTTCATTGAGAGCCCAGGCAA | | F2 | 2615–2652 | 21 | CTTTGATGGCTCTGTTTCAAC | | B2 | 2753–2773 | 20 | CATCAACAATTGCATACCCT | | F1c | 2667–2635 | 21 | GCTGACTGAACCCCAGTTTGT | | B1c | 2696–2715 | 20 | GGACGCAGAGGGCATTTCAG |
|
|
aRVFV ZH-501 strain (genebank accession code: M11157.1).
|