Research Article
Shifts in Nitrification Kinetics and Microbial Community during Bioaugmentation of Activated Sludge with Nitrifiers Enriched on Sludge Reject Water
Table 1
List of 16S rRNA-targeted oligonucleotide probes used in the study.
| Probe | Sequence (5′-3′) | Specificity | Concentration*(%) | Reference |
| NSO1225 | CGCCATTGTATTACGTGTGA | Ammonia oxidizing beta-proteobacteria | 35 | Mobarry et al. [17] | Nsv443 | CCGTGACCGTTTCGTTCCG | Nitrosospira spp. | 30 | Mobarry et al. [17] | Nmv (Ncmob) | TCCTCAGAGACTACGCGG | Nitrosococcus mobilis lineage | 35 | Juretschko et al. [18] | Ntspa662 | GGAATTCCGCGCTCCTCT | Nitrospira | 35 | Daims et al. [19] | NIT3 | CCTGTGCTCCATGCTCCG | Nitrobacter | 40 | Wagner et al. [20] | Ntcoc206 | CGGTGCGAGCTTGCAAGC | Nitrococcus mobilis | 10 | Juretschko et al. [21] | Ntspn693 | TTCCCAATATCAACGCATT | Nitrospina gracilis | 20 | Juretschko et al. [21] |
|
|
*Concentrations presented as percentage of formamide in hybridization buffer (v/v).
|