Research Article
Quorum Sensing and Spoilage Potential of Psychrotrophic Enterobacteriaceae Isolated from Milk
Table 2
Primers used to amplify halI and halR genes by PCR.
| Primer | Sequence (5’-3’) | Application |
| halI-F | AACTGATTACACCAATGCAGT | Amplification of halI | halI-R | GGAATGCTTGAACTATTTGATG | Amplification of halI | halI-bam | ATTGGATCCTACACCAATGCAGTCTTAATT | Amplification of halI gene and preparation for cloning in pQE-30Xa | halI-sac | ATTGAGCTCATGCTTGAACTATTTGATGTC | Amplification of halI gene and preparation for cloning in pQE-30Xa | halR-F | CTT CAG GGA TGC CAT ATG TTT | Amplification of halR | halR-R | ACT GCA TTG GTG TAA TCA GTT | Amplification of halR |
|
|
The introduced restriction sites for BamHI and SacI are underlined.
|