Research Article
Detection of Metalloproteases and Cysteine Proteases RNA Transcripts of Leishmania (Leishmania) infantum in Ear Edge Skin of Naturally Infected Dogs
Table 1
Pairs of primers designed for the analysis of the expression of target genes for Leishmania spp. and dog using PCR assays.
| | GeneDB ID | Gene-target | Primers foward/reverse | Product size (pb) |
| Leishmania spp. genes | LinJ.10.0501 | Metallo protease: gp63, leishmanolysin | 5 GGGTAGGGGCGTTCTGC 3 5 CCCGGCCTATTTTACACCAACC 3 | 202 | LinJ.10.0510 | LbrM.10.0610 | LbrM.10.0590 | LbrM.08.0810 | Cysteine protease: cathepsin L-like protease | 5 GGGTAGGGGCGTTCTGC 3 5 CCCGGCCTATTTTACACCAACC 3 | 227 | LbrM.08.0820 | LbrM.08.0830 | LinJ.08.0960 | M94088 | Kinetoplast minicircle 3 (kDNA3) | 5 CTGATCCACTGTTTTCTCCCCA 3 5 AAAGTGCCCGTGAGTACAGG 3 | 120 |
| Canis lupus familiaris | LOC106557476 | α-Tubulin | 5 GGGTAGGGGCGTTCTGC 3 5 CCCGGCCTATTTTACACCAACC 3 | 160 | XM_003124280.5 | β-Actin | 5 CTGATCCACTGTTTTCTCCCCA 3 5 AAAGTGCCCGTGAGTACAGG 3 | 87 |
|
|