Research Article
Lanthanum Chloride Causes Neurotoxicity in Rats by Upregulating miR-124 Expression and Targeting PIK3CA to Regulate the PI3K/Akt Signaling Pathway
Table 1
The primer sequences of miR-124 and U6.
| Gene name | The primer sequences (5⟶3) |
| miR-124 upstream primer | GCTAAGGCACGCGGTG | miR-124 downstream primer | GTGCAGGGTCCGAGGT | U6 upstream primer | CTCGCTTCGGCAGCACA | U6 downstream primer | AACGCTTCACGAATTTGCGT |
|
|