Research Article
Comprehensive Profile Analysis of Differentially Expressed circRNAs in Glucose Deprivation-Induced Human Nucleus Pulposus Cell Degeneration
Table 1
Sequences of primers used for qRT-PCR.
| | Name | Sequence | Product size (bp) |
| | circ_0075062 | F: AAATGGCACCCTACGTGGAC | 107 | | R: TCCCCAGTTCTGCTCACACT |
| | 18S | F: AGTCGCCGTGCCTACCAT | 129 | | R: CGGGTCGGGAGTGGGTAAT |
| | Divergent | F: AAATGGCACCCTACGTGGAC | 107 | | R: TCCCCAGTTCTGCTCACACT |
| | Convergent | F: TATCAAACAGCGACATAGCCATAC | 100 | | R: ACTCCCCAGGTGTGTATTTTCC |
|
|