Research Article
Carbapenemase Production and Detection of Colistin-Resistant Genes in Clinical Isolates of Escherichia Coli from the Ho Teaching Hospital, Ghana
Table 1
Oligonucleotide primers used for the molecular identification of E. coli.
| | Target gene | Sequence (5′-3′) | Amplicon size (bp) | Reference |
| | uspA | F_CCGATACGCTGCCAATCAGT | 884 | [13] | | R_ACGCAGACCGTAGGCCAGAT |
| | uidA | F_CTGGTATCAGCGCGAAGTCT | 556 | [13] | | R_AGCGGGTAGATATCACACTC |
|
|