RETRACTED: The Roles of KIFC1 in the Development of Osteosarcoma: Characterization of Potential Therapeutic Targets

Liang, Li-Yan; Li, Gui-Shi

doi:https://doi.org/10.1155/2022/5039134

Computational and Mathematical Methods in Medicine

On this page

Abstract Introduction Materials and Methods Results Discussion Conclusion Data Availability Conflicts of Interest Authors’ Contributions Acknowledgments Supplementary Materials References Copyright Related Articles

Research Article Retraction

!

This article has been Retracted. To view the article details, please click the ‘Retraction’ tab above.

Special Issue

Artificial Intelligence for Biological Sequence and Functional Analysis

View this Special Issue

Research Article | Open Access

Volume 2022 | Article ID 5039134 | https://doi.org/10.1155/2022/5039134

RETRACTED: The Roles of KIFC1 in the Development of Osteosarcoma: Characterization of Potential Therapeutic Targets

Li-Yan Liang¹and Gui-Shi Li²

Academic Editor: Xiucai Ye

Received28 Feb 2022

Revised17 Mar 2022

Accepted21 Mar 2022

Published18 Apr 2022

Abstract

Background. As an important member of the mitotic kinesin family, kinesin family member C1 (KIFC1) is abnormally expressed in a variety of tumors. However, the roles of KIFC1 in the development of osteosarcoma (OS) have never been elucidated. Methods. The expression of KIFC1 in OS tissues which was detected by immunohistochemistry (IHC) staining was further confirmed by Gene Expression Profiling Interactive Analysis 2 (GEPIA2) database. The relationship between KIFC1 and CDC20 was analyzed by clinical data, STRING database, and GEPIA2 database. Survival analysis was performed through GEPIA2 database. To elucidate the roles of KIFC1 in OS, MG-63 and U-2 OS cells were treated with short hairpin RNA (shRNA) to knock down KIFC1 expression, and the knockdown efficiency was validated with quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and western blotting (WB). Moreover, colony formation and Cell Counting Kit-8 (CCK-8) assays were utilized to evaluate cell proliferation. Results. According to IHC staining and GEPIA2 analysis, the expression of KIFC1 in OS tissues was significantly higher than that in adjacent normal tissues, which was inversely connected to the prognosis. These results were consistent with our clinical data. Besides, KIFC1 was positively correlated with CDC20. In addition, KIFC1 shRNA could effectively silence KIFC1 expression in MG-63 and U-2 OS cells. Furthermore, the knockdown of KIFC1 inhibited the cell proliferation ability with increased cell apoptosis in MG-63 and U-2 OS cells. Conclusion. KIFC1 was significantly upregulated in OS and promoted OS progression by cell proliferation. These findings offered new clues for OS diagnosis and prognosis, suggesting KIFC1 could be a potential therapeutic target for OS in further study.

1. Introduction

Osteosarcoma (OS) originates in mesenchymal tissue is one of the most common primary malignant bone tumors global, predominantly affecting the population of adolescents under 18 and elderly over 60 [1–3]. With the rapid development of surgery technology, intensive multiagent chemotherapy, and medical equipment, the 5-year survival rate of OS patients without metastases has increased to nearly 70–80% [4, 5]. However, due to early systemic metastases, the 5-year survival rate of patients with OS metastases is just 20% [6]. Current therapeutic options for metastatic OS are limited and frequently result in poor prognosis and relapse. Therefore, the exploration of novel molecular therapeutic targets for early diagnosis and treatment in OS is both imperative and useful.

Kinesin family member C1 (KIFC1) is a minus-end-directed kinesin motor protein that participates in a range of cellular biological processes including mitosis, meiosis, centrosome amplification, and macromolecular transport [7, 8]. Increasing evidence reports that KIFC1 expression is abnormal in various cancers, such as ovarian adenocarcinomas, breast cancer, bladder cancer, and glioblastoma [9–12]. Concretely speaking, KIFC1 was upregulated in ovarian cancer cells and could serve as a biomarker that predicted worse prognosis, poor overall survival, and initiation of metastatic dissemination in patients with ovarian cancer. KIFC1 was also found to be highly expressed in premalignant lesions and performed important roles in enabling preneoplastic cells to become immortalized and malignant. In addition, KIFC1 was highly expressed in bladder cancer and could be a promising biomarker and therapeutic target. Moreover, the expression of KIFC1 was upregulated in glioblastoma, and it was critical in the involvement and progression of glioblastoma. Recently, KIFC1 has emerged as a hallmark and is considered to be an attractive target for the treatment and diagnosis of human cancers. KIFC1 inhibition can significantly limit cell proliferation, motility, and drug resistance [12, 13]. Alternatively, the roles and probable mechanisms of KIFC1 in OS are still unknown.

In this study, we performed immunohistochemistry (IHC) staining and bioinformatics to analyze the prognostic value of KIFC1 and examined the association between KIFC1 and CDC20 in OS. We also investigated the association between KIFC1 and grade classification and analyzed the role of KIFC1 in cell proliferation. We found that in highly consistent with CDC20, KIFC1 was significantly upregulated in OS patients. High KIFC1 level was associated with the poor prognosis of OS patients. In addition, KIFC1 silencing inhibited cell proliferation in vitro. Our results suggest that KIFC1 was a potential biomarker for OS diagnosis, treatment, prognosis, and recurrence.

2. Materials and Methods

2.1. Patient Samples

55 pairs of OS tissues and matched adjacent normal tissues were collected from the Yantai Yuhuangding Hospital. Their diagnosis was according to risk factors, presenting symptoms, and diagnostic testing. Furthermore, the final diagnosis was dependent on pathological and IHC staining. Every participant signed written informed consent. Following surgical resection, the fresh tissue was sent for pathological analysis, and the rest was immediately frozen in liquid nitrogen. The experiments were approved by the ethics committee of Yantai Yuhuangding Hospital. The clinical staging criteria were based on the Enneking staging system [14] was shown in Supplement Table 1.

2.2. Exclusion and Inclusion Criteria

The exclusion criteria used in our study were as follows: (1) patients without surgery; and (2) patients received chemotherapy, radiotherapy, and/or other treatments. The inclusion criteria used in our study were as follows: (1) assessment of the association between KIFC1, CDC20, and IHC staining of patients; (2) patient with detailed clinical information; and (3) patients did not receive any chemotherapy or radiotherapy before surgery.

2.3. Immunohistochemistry Staining

IHC staining was used to evaluate the expression of KIFC1 and CDC20 and their relationship in each tissue. Briefly, 5 μm thick specimens were fixed using 4% paraformaldehyde (PFA) at 25°C for 30 min before being blocked with 2% bovine serum albumin (BSA) for 1 hour. Subsequently, after slides were incubated with rabbit anti-KIFC1 (ab172620, 1 : 100; Abcam, Shanghai, China) and anti-CDC20 antibody (ab155921, 1 : 200; Abcam, Shanghai, China) at 4°C overnight. The slices were stained with the universal secondary antibodies (Zhongshan Jinqiao Biotechnology Co., Ltd., Beijing, China) for 1 hour the next day, and diaminobenzidine was utilized as a chromogen substrate. Finally, photographs were automatically restored and analyzed by the optical microscope (Olympus, Japan). The H-score system was applied to calculate each slice. The cutoff criteria were set as to discriminate the high (≥200) and low (<200) expression groups.

2.4. Bioinformatics Analysis

As an online tool, Gene Expression Profiling Interactive Analysis 2 (GEPIA2) is frequently employed for integrating analysis of gene expression in TGGA and GTEx datasets [15]. In this study, we used GEPIA2 to analyze the KIFC1 expression between tumor and normal patients in SARC via box plots. The significantly abnormal gene expression is denoted with “,” which represents .

In addition, GEPIA2 can perform survival and correlation analysis based on gene expression. Therefore, the overall survival and disease free survival of KIFC1 were performed with GEPIA2 to evaluate its prognostic value. Moreover, the correlation between KIFC1 and CDC20 was also performed by GEPIA2.

2.5. Cell Culture

The OS cell lines MG-63 and U-2 OS were purchased from the Chinese Academy of Sciences (Shanghai, China). All cells were cultivated in medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (Gibco, Thermo Fisher Scientific, Inc.) at 37°C with 5% CO₂.

2.6. Cell Transfection

Lentiviral vectors with short hairpin RNAs (shRNAs) against KIFC1 and their matching negative controls were designed and developed by ObiO (Shanghai, China). The TransFast transfection reagent Lipofectamine 2000 (Thermo Fisher Scientific) was then used to transfect cells through the vectors. To establish stable cell lines, an incubator with puromycin (5.0 μg/mL, Biyuntian) was employed to culture cells for 14 days. Target sequences were as follows: sh1: 5-AAATTACCACATCCCACCCAAGA-3, sh2: 5-AAACGTTGGACCAAGAGAACCAG-3, sh3: 5-AAGTGGACAGGATGAAGTGTTTG-3, and sh4: 5-AACAGCAAACTGACCTACCTGCT-3. Transfection efficiency was verified by quantitative real-time polymerase chain reaction (qRT-PCR) and western blotting (WB) assays. Finally, sh1 was preferred for further experiments.

2.7. Western Blotting

The radioimmunoprecipitation assay (RIPA) buffer (Beyotime, Shanghai, China) was used to isolate total protein from treated OS cells before quantifying the protein concentration with Bicinchoninic acid (BCA) protein analysis kit (Beyotime, Shanghai, China). After separating with 12% SDS-PAGE gel (Beyotime, Shanghai, China), the proteins were transferred to the polyvinylidene fluoride (PVDF, Beyotime, Shanghai, China) membrane which was further blocked by Tris-buffered saline contained 0.1% Tween20 (TBST, Beyotime, Shanghai, China) solution containing 5% skim milk for 2 hours at room temperature. Then, the membranes were soaked with primary antibodies, namely, anti-KIFC1 (ab172620, 1 : 10000; Abcam, Shanghai, China), anti-CDC20 antibody (ab155921, 1 : 1000; Abcam, Shanghai, China), and β-actin (1 : 1000, Abcam, Shanghai, China) at 4°C overnight. Subsequently, the membranes were incubated for another 2 hours at room temperature with secondary antibodies before being washed three times with TBST (10 minutes each time). Finally, the proteins were visualized with the VersaDoc Imaging System (BioRad Laboratories Co., San Francisco, CA, USA) and quantified by the Image J software.

2.8. Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)

Utilizing TRIzol reagent (Invitrogen, Shanghai, China), total RNA was extracted from treated OS cells () before cDNA synthesis with PrimeScript II 1st Strand cDNA Synthesis Kit (Takara, Shanghai, China). Then, qRT-PCR was carried out by ABI PRISM 7900 Real-Time system (Applied Biosystems, Foster City, CA, USA) with the SYBR Premix Ex Taq II (Takara). The relative expression was calculated with the 2−ΔΔct method compared to GAPDH. The following primers were used for qRT-PCR: KIFC1 forward (5-3): TGAGCAACAAGGAGTCCCAC and reverse (5-3): TCACTTCCTGTTGGCCTGAG, and GAPDH forward (5-3): CATGAGAAGTATGACAACAGCCT and GAPDH reverse (5-3): AGTCCTTCCACGATACCAAAGT.

2.9. Colony Formation Assay

After being treated with shRNA or control, OS cells were plated onto 6-well plates (1000 cells/well) at room temperature for 2 weeks. After washing thrice with phosphate buffer solution (PBS, Solarbio, Beijing, China), visible colonies were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet at room temperature for 30 minutes. Finally, the images of colony formation were taken and analyzed.

2.10. Cell Viability

The Cell Counting Kit-8 (CCK-8) assay was applied to detect cell viability following transfection. Briefly, MG-63 or U-2 OS cells were inoculated with cells/well on 96-well plates. Subsequently, 10 μL CCK-8 solution and 90 μL medium (Beyotime, Shanghai, China) were added to each well and incubated for 3 h at 37°C. The optical density (OD) value of each sample was measured at 570 nm with a microplate reader (BioTek, Winooski, VT, USA).

2.11. Statistical Analyses

All the data expressed as the was analyzed by the SPSS 22.0 statistical software. The statistical differences between the two groups were analyzed with a two-tailed Student’s -test, while multiple group comparisons were performed by one-way analyses of variance (ANOVA). The test was performed to analyze the correlation between KIFC1 expression and clinicopathological characteristics. The correlation and survival analysis were calculated by the Pearson and the log-rank test, respectively. Every experiment was conducted at least three times. The cutoff of significant difference was .

3. Results

3.1. KIFC1 Was Highly Expressed in OS Patients

To explore the functions of KIFC1 in OS, we preliminarily analyzed the expression of KIFC1 and the clinicopathological features in 55 OS patients. Firstly, the IHC staining data presented that the expression of KIFC1 in OS tissues was significantly higher than that in adjacent normal tissues (Figure 1(a)). Secondly, correlation analysis revealed that KIFC1 expression level was positively correlated with age, gender, tumor size, and clinical stage in OS patients (Table 1). In addition, compared to normal people, KIFC1 was significantly upregulated in OS patients in GEPIA2 database (Figure 1(b)). Comprehensive analysis revealed that higher expression of KIFC1 was accompanied by the deepening of tumor malignancy in OS patients. Conversely, these results proved that KIFC1 might be an important oncogenic gene and therapeutic target for OS.

(a)

(b)

3.2. The Relationship between KIFC1 and CDC20 Expression

Cell division cycle 20 homologue (CDC20) has been proved to play important roles in carcinogenesis and development of OS in previous studies [16–18]. Therefore, we sought to test whether KIFC1 interacts with CDC20 played critical functions in OS. Firstly, IHC staining was used to detect the relationship between KIFC1 and CDC20. As shown in Figure 2(a), both KIFC1 and CDC20 were overexpressed in OS patients. Specifically, the increased expression of KIFC1 was accompanied by the high expression of CDC20. The relationships of KIFC1 and CDC20 in 55 patients with osteosarcoma were presented in Table 2. Then, the GEPIA2 and STRING were preferred to confirm their correlation. As represented in Figures 2(b) and 2(c), KIFC1 and CDC20 were closely related in OS. In detail, the RNA coexpression score between KIFC1 and CDC20 was 0.918 with STRING. Moreover, Pearson correlation analysis revealed a significantly positive correlation between KIFC1 and CDC20 through GEPIA2 (, ). Taken together, CDC20 and KIFC1 were highly correlated with each other, which demonstrated that they were associated with the development and progression of OS.

(a)

(b)

(c)

3.3. Survival and Prognostic Value of KIFC1 in Osteosarcoma

GEPIA2 was used to further assess the prognostic value of KIFC1 in OS. The overall survival result (Figure 3(a)) revealed that OS patients with high expression of KIFC1 had a worse prognosis compared to those with low expression of KIFC1 (, ). In addition, the disease free survival (DFS) (Figure 3(b)) showed significant difference between these two groups (, ). Our results verified that high KIFC1 expression led to a worse prognosis, indicating that KIFC1 could be an independent prognostic factor of OS.

(a)

(b)

3.4. KIFC1 shRNA Transfection Decreased KIFC1 Expression

To investigate the role of KIFC1 in OS cells, KIFC1 shRNA and control empty vector were transfected into MG-63 and U-2 OS cells, respectively. Then, we measured the expression of KIFC1 at both mRNA and protein levels in OS cells by qRT-PCR and WB analysis. Our qRT-PCR data demonstrated that KIFC1 mRNA level was significantly knocked down in MG-63 and U-2 OS cells after KIFC1 shRNA transfection (Figure 4(a)). Moreover, our WB results indicated that the protein level of KIFC1 was decreased in both MG63 and U-2 OS cells transfected with KIFC1 shRNA (Figure 4(b)). These results revealed that KIFC1 shRNA significantly inhibited the KIFC1 expression in OS cells, which could be applied for further function experiments.

(a)

(b)

3.5. Knockdown of KIFC1 Inhibited the Proliferation of Osteosarcoma Cells

Then, the effects of KIFC1 on OS cell proliferation were determined with colony formation assay and CCK-8 assay. As shown in Figure 5(a), according to the colony formation assay, the number of clones in the cells transfected with KIFC1 shRNA was remarkably less than that in the control group. In addition, OD value of CCK-8 assay was significantly decreased in the KIFC1 shRNA group compared with the control group (Figure 5(b)). The result indicated that the knockdown of KIFC1 with KIFC1 shRNA could significantly inhibit the proliferation of MG-63 and U-2 OS cells. These founding revealed the key cancer-promoting function of KIFC1 in OS cells.

(a)

(b)

4. Discussion

As the most common skeletal malignancy, OS is characterized by early metastasis, recurrence, drug resistance, and rapid progression [19–22]. Therefore, it is of great significance to identify innovative therapeutic regimens or targets to improve the diagnosis and prognosis of OS patients.

As a microtubule-dependent mitotic kinesin with ATP activity, KIFC1 is involved in a range of cellular activities including mitosis, meiosis, and macromolecular transport [23]. Previous in-depth studies have demonstrated that KIFC1, which is closely associated with the occurrence and progression of gastric cancer, hepatocellular carcinoma, ovarian adenocarcinomas, and breast cancer, maybe emerged as a potential target for further study of tumor treatment [10, 24–26]. However, little is known about the expression and effects of KIFC1 in human OS. Our present study showed that KIFC1 was highly expressed in OS patients, and its expression had a significant positive correlation with the pathological clinical stage and tumor size of OS. As CDC20 has been reported to be involved in the development of OS that regulates the cell cycle [17, 27], we further explored the function of KIFC1 with coexpression analysis by STRING and GEPIA2. In consistent with previous findings, CDC20 was upregulated in OS patients. In addition, KIFC1 was positively related to CDC20 which revealed that KIFC1 played critical roles in OS. Furthermore, survival analysis confirmed that OS patients with overexpression of KIFC1 had a worse prognosis suggesting that KIFC1 could serve as a reliable candidate biomarker for diagnosis, treatment, and prognosis of OS. Hence, cellular level experiments including cell transfection, colony formation, and CCK-8 assays confirmed the importance of KIFC1 in the pathogenesis of OS. In particular, our results demonstrated that KIFC1 was highly expressed in MG-63 and U-2 OS cells, and silencing of KIFC1 by transfection of cells with KIFC1 shRNA inhibited the proliferation of OS cells. These results also suggested that KIFC1 promoted the tumorigenesis and progression of OS. However, there were certain shortages in our study. For example, more in vitro experiments needed to uncover the accurate mechanisms of OS. Also, the number of patients involved in our manuscript was not large enough, and a large sample of OS patients needed to further prove our conclusions. Moreover, in vivo experiments were not performed to evaluate the functions of KIFC1 on OS tumorigenesis.

5. Conclusion

In our study, we combined the use of bioinformatics with in vitro experiments to confirm the overexpression of KIFC1 in OS. We further revealed that silencing of KIFC1 by transfection of MG-63 and U-2 OS cells with KIFC1 shRNA inhibited the proliferation of OS cells. To the best of our knowledge, this was the first study to demonstrate that KIFC1 participated in OS progression, which could serve as an independent risk factor for poor prognosis of OS. Moreover, the present study provided a new area of research for the exploration of OS diagnosis, treatment, and prognosis in further study.

Data Availability

The datasets utilize in this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare that there are no competing interests.

Authors’ Contributions

Li-Yan Liang designed this study and drafted the manuscript. Gui-Shi Li performed the experiment and revised the manuscript. The experiment data was collected and analyzed by Li-Yan Liang. Gui-Shi Li managed all works of the project. All authors read and approved the final manuscript.

Acknowledgments

This study was supported by the Shandong Province Medical and Health Plan, 202104071008.

Supplementary Materials

Supplement Table 1: Enneking staging system for osteosarcoma. (Supplementary Materials)

References

L. R. Sadykova, A. I. Ntekim, M. Muyangwa-Semenova et al., “Epidemiology and risk factors of osteosarcoma,” Cancer Investigation, vol. 38, no. 5, pp. 259–269, 2020.
View at: Publisher Site | Google Scholar
D. M. Gianferante, L. Mirabello, and S. A. Savage, “Germline and somatic genetics of osteosarcoma - connecting aetiology, biology and therapy,” Nature Reviews. Endocrinology, vol. 13, no. 8, pp. 480–491, 2017.
View at: Publisher Site | Google Scholar
D. J. Harrison, D. S. Geller, J. D. Gill, V. O. Lewis, and R. Gorlick, “Current and future therapeutic approaches for osteosarcoma,” Expert Review of Anticancer Therapy, vol. 18, no. 1, pp. 39–50, 2018.
View at: Publisher Site | Google Scholar
J. Gill and R. Gorlick, “Advancing therapy for osteosarcoma,” Nature Reviews. Clinical Oncology, vol. 18, no. 10, pp. 609–624, 2021.
View at: Publisher Site | Google Scholar
I. Gazouli, A. Kyriazoglou, I. Kotsantis et al., “Systematic review of recurrent osteosarcoma systemic therapy,” Cancers (Basel), vol. 13, no. 8, p. 1757, 2021.
View at: Publisher Site | Google Scholar
Y. Gao, C. Guo, S. Fu, Y. Cheng, and C. Song, “Downregulation of CDC20 suppressed cell proliferation, induced apoptosis, triggered cell cycle arrest in osteosarcoma cells, and enhanced chemosensitivity to cisplatin,” Neoplasma, vol. 68, no. 2, pp. 382–390, 2021.
View at: Publisher Site | Google Scholar
O. Rath and F. Kozielski, “Kinesins and cancer,” Nature Reviews. Cancer, vol. 12, no. 8, pp. 527–539, 2012.
View at: Publisher Site | Google Scholar
S. Venuto, L. Monteonofrio, F. Cozzolino et al., “TRIM8 interacts with KIF11 and KIFC1 and controls bipolar spindle formation and chromosomal stability,” Cancer Letters, vol. 473, pp. 98–106, 2020.
View at: Publisher Site | Google Scholar
S. Pawar, S. Donthamsetty, V. Pannu et al., “KIFCI, a novel putative prognostic biomarker for ovarian adenocarcinomas: delineating protein interaction networks and signaling circuitries,” Journal of Ovarian Research, vol. 7, no. 1, p. 53, 2014.
View at: Publisher Site | Google Scholar
N. Wright, Z. Gong, R. Kittles et al., “Kinesin family member C1 (KIFC1/HSET): a potential actionable biomarker of early stage breast tumorigenesis and progression of high-risk lesions,” Journal of Personalized Medicine, vol. 11, no. 12, p. 1361, 2021.
View at: Publisher Site | Google Scholar
Y. Sekino, Q. T. Pham, K. Kobatake et al., “KIFC1 is associated with basal type, cisplatin resistance, PD-L1 expression and poor prognosis in bladder cancer,” Journal of Clinical Medicine, vol. 10, no. 21, p. 4837, 2021.
View at: Publisher Site | Google Scholar
J. Wu, X. Wang, X. Yuan et al., “Kinesin family member C1 increases temozolomide resistance of glioblastoma through promoting DNA damage repair,” Cell Transplantation, vol. 30, article 096368972199146, 2021.
View at: Publisher Site | Google Scholar
Y. Sekino, N. Oue, Y. Shigematsu et al., “KIFC1 induces resistance to docetaxel and is associated with survival of patients with prostate cancer,” Urologic Oncology, vol. 35, no. 1, pp. 31.e13–31.e20, 2017.
View at: Publisher Site | Google Scholar
W. F. Enneking, S. S. Spanier, and M. A. Goodman, “A system for the surgical staging of musculoskeletal sarcoma,” Clinical Orthopaedics and Related Research, vol. 153, no. &NA;, pp. 106???120–106???120, 1980.
View at: Publisher Site | Google Scholar
Z. Tang, B. Kang, C. Li, T. Chen, and Z. Zhang, “GEPIA2: an enhanced web server for large-scale expression profiling and interactive analysis,” Nucleic Acids Research, vol. 47, no. W1, pp. W556–W560, 2019.
View at: Publisher Site | Google Scholar
Y. Gao, B. Zhang, Y. Wang, and G. Shang, “Cdc20 inhibitor apcin inhibits the growth and invasion of osteosarcoma cells,” Oncology Reports, vol. 40, no. 2, pp. 841–848, 2018.
View at: Publisher Site | Google Scholar
C. Long, J. Chen, H. Zhou et al., “Diosgenin exerts its tumor suppressive function via inhibition of Cdc20 in osteosarcoma cells,” Cell Cycle, vol. 18, no. 3, pp. 346–358, 2019.
View at: Publisher Site | Google Scholar
M. S. Wu, Q. Y. Ma, D. D. Liu et al., “CDC20 and its downstream genes: potential prognosis factors of osteosarcoma,” International Journal of Clinical Oncology, vol. 24, no. 11, pp. 1479–1489, 2019.
View at: Publisher Site | Google Scholar
N. Gaspar, R. Venkatramani, S. Hecker-Nolting et al., “Lenvatinib with etoposide plus ifosfamide in patients with refractory or relapsed osteosarcoma (ITCC-050): a multicentre, open-label, multicohort, phase 1/2 study,” The Lancet Oncology, vol. 22, no. 9, pp. 1312–1321, 2021.
View at: Publisher Site | Google Scholar
S. E. Leary, A. W. Wozniak, C. A. Billups et al., “Survival of pediatric patients after relapsed osteosarcoma: the St. Jude Children's Research Hospital experience,” Cancer, vol. 119, no. 14, pp. 2645–2653, 2013.
View at: Publisher Site | Google Scholar
J. Long, W. Zhang, Y. Chen et al., “Multifunctional magnesium incorporated scaffolds by 3D-printing for comprehensive postsurgical management of osteosarcoma,” Biomaterials, vol. 275, article 120950, 2021.
View at: Publisher Site | Google Scholar
D. P. Regan, L. Chow, S. Das et al., “Losartan blocks osteosarcoma-elicited monocyte recruitment, and combined with the kinase inhibitor toceranib, exerts significant clinical benefit in canine metastatic osteosarcoma,” Clinical Cancer Research, vol. 28, no. 4, pp. 662–676, 2022.
View at: Publisher Site | Google Scholar
S. Cai, L. N. Weaver, S. C. Ems-McClung, and C. E. Walczak, “Kinesin-14 family proteins HSET/XCTK2 control spindle length by cross-linking and sliding microtubules,” Molecular Biology of the Cell, vol. 20, no. 5, pp. 1348–1359, 2009.
View at: Publisher Site | Google Scholar
K. Teng, S. Wei, C. Zhang et al., “KIFC1 is activated by TCF-4 and promotes hepatocellular carcinoma pathogenesis by regulating HMGA1 transcriptional activity,” Journal of Experimental & Clinical Cancer Research, vol. 38, no. 1, p. 329, 2019.
View at: Publisher Site | Google Scholar
N. Oue, S. Mukai, T. Imai et al., “Induction of KIFC1 expression in gastric cancer spheroids,” Oncology Reports, vol. 36, no. 1, pp. 349–355, 2016.
View at: Publisher Site | Google Scholar
K. Mittal, D. H. Choi, S. Klimov et al., “A centrosome clustering protein, KIFC1, predicts aggressive disease course in serous ovarian adenocarcinomas,” Journal of Ovarian Research, vol. 9, no. 1, p. 17, 2016.
View at: Publisher Site | Google Scholar
G. Shang, X. Ma, and G. Lv, “Cell division cycle 20 promotes cell proliferation and invasion and inhibits apoptosis in osteosarcoma cells,” Cell Cycle, vol. 17, no. 1, pp. 43–52, 2018.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2022 Li-Yan Liang and Gui-Shi Li. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies