Research Article

Mitochondrial ATP-Sensitive K+ Channel Opening Increased the Airway Smooth Muscle Cell Proliferation by Activating the PI3K/AKT Signaling Pathway in a Rat Model of Asthma

Table 1

The PCR primer sequences.

GeneSequenceSize (bp)Tm (°C)

AKT
 SenseATGGACTTCCGGTCAGGTTCA12662
 AntisenseGCCCTTGCCCAGTAGCTTCA
GAPDH
 SenseGGCACAGTCAAGGCTGAGAATG14361.5
 AntisenseATGGTGGTGAAGACGCCAGTA

Note. All sequences are shown in the 5′ to 3′ orientation. bp: base pair; Tm: temperature; AKT: protein kinase B; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.