Research Article
Herb-Partitioned Moxibustion Regulates the TLR2/NF-κB Signaling Pathway in a Rat Model of Ulcerative Colitis
Table 1
The gene sequences of the primers.
| | ID | Primer name | Sequence (5′ to 3′) | Base number |
| | gi392350511refXM_003750630.1 | TLR2-domain | CCCAAGCACACTCACTCAACT | 20 | | gi189011593refNM_001127555.1 | IRAK-1 | CAAGGAGGCACTACCAGAGAAT | 22 | | gi158508715refNM_053355.2 | IKK-β | CCAAGAGACCAAAGGACAGAAG | 22 |
|
|