Research Article
Effects of Erbuzhuyu Decoction Combined with Acupuncture on Endometrial Receptivity Are Associated with the Expression of miR-494-3p
| Gene | Sequences |
| miR-494-3p | Forward: ATCCAGTGCGTGTCGTG | Reverse: Mir-X miRNA qRT-PCR TB Green® kit provided | HOXA10 | Forward: CTCTCTCCCCCTCACACTC | Reverse: ACAAAACCACCAAAGCAAACACACA | U6 | Mir-X miRNA qRT-PCR TB Green® kit provided | GADPH | Forward: GGTTGTCTCCTGCGACTTCA | Reverse: GGTGGTCCAGGGTTTCTTACT |
|
|