Research Article
[Retracted] Fut7 Promotes Adhesion and Invasion of Acute Lymphoblastic Leukemia Cells through the Integrin/Fak/Akt Pathway
| | Primer | Sequences (5′-3′) |
| | FUT7 | Forward | GAATGAGAGCCGATACCAACGC | | Reverse | TAGCGGTCACAGATGGCACAGA | | GAPDH | Forward | GGAGCGAGATCCCTCCAAAAT | | Reverse | GGCTGTTGTCATACTTCTCATGG |
|
|