Research Article

COG6-CDG: Two Novel Variants and Milder Phenotype in a Chinese Patient

Table 1

Primers used for effects of variants on RNA decay or splicing.

Amplified regionPrimer nameSequence (5-3)Length of PCR product (WTa/Mut)

COG6_exons 15-18c1672_FTCATGTGTCTTGGATCCTCTCC402 bp402 bp
c1672_RCACTGTGGCACTTAGAAGAAAGT

COG6_exon 1-3c153_FTGCCAACGGCCTCAACAAGG263 bp417 bp
c153_RTGCTTTCAAGTTCCTCCTTCACT328 bp482 bp

aThere are two wild-type (WT) manuscripts (NM_020751.3, 263 bp, and NR_026745.1, 328 bp), owing to an additional splicing site in intron 1.