Isolation and Characterization of Viscosity-Reducing and Biosurfactant-Producing Bacteria in Low-Permeability Reservoir

Ziwei, Bian; Hanning, Wu; Lusha, Wei; Zena, Zhi; Yifei, Wu

doi:https://doi.org/10.1155/2023/3223516

International Journal of Energy Research

On this page

Abstract Introduction Materials and Methods Results Discussion Conclusion Data Availability Conflicts of Interest Authors’ Contributions Acknowledgments Supplementary Materials References Copyright Related Articles

Research Article | Open Access

Volume 2023 | Article ID 3223516 | https://doi.org/10.1155/2023/3223516

Isolation and Characterization of Viscosity-Reducing and Biosurfactant-Producing Bacteria in Low-Permeability Reservoir

Bian Ziwei,¹Wu Hanning,¹Wei Lusha,²Zhi Zena,¹and Wu Yifei³

Academic Editor: Sanjay Basumatary

Received08 Sept 2022

Revised20 Nov 2022

Accepted07 Dec 2022

Published06 Feb 2023

Abstract

Microbialenhanced oil recovery has gained more attention in recent years due to its low cost and eco-friendliness. However, studies on the application of this technique in the low-permeability reservoirs are few. In this study, eight strains from the Ordos Basin low-permeability reservoir that produce biosurfactant and reduce viscosity were identified. Strains could produce biosurfactants (lipopeptide and glycolipids) to emulsify the oil and had good tolerance on temperature (25°C-50°C), salinity (1 g/L-50g/L), and pH (5-10). After the actions of A-3, SC4534(2), SC4561, and JSC4535, the content of long-chain n-alkanes were decreased by 51.2%, 28.3%, 35.2%, and 28.9%, respectively. The naphthalene in aromatic hydrocarbons was also effectively degraded by the strains that were screened, and the degradation rate was higher than 84%. Additionally, all strains were able to reduce oil viscosity, which was reduced by 27-51% (in seven days). 16S rRNA gene sequencing analysis indicated that seven strains belong to the genus Bacillus and one belongs to the genus Rhodospirillaceae. The results revealed that the existence of high-efficiency strains that can significantly improve the properties of crude oil in low-permeability oil fields though biodegradation and use of biosurfactants, which is of great significance for the application of MEOR in low-permeability oil fields.

1. Introduction

Low-permeability reservoirs are those with permeability less than 50 mD [1]. 46% of China’s total oil and gas resources are low-permeability resources. To ensure the sustainable development of oil and gas in China, the efficient development of oil and gas resources in low permeability reservoirs is of considerable strategic significance. However, such resources often have unsatisfactory recovery rates due to their complex geological conditions [1, 2]. Microbial-enhanced oil recovery (MEOR), which uses microbial propagation and metabolic products to change the properties of oil and reservoirs and hence increase oil recovery, has gradually gained attention due to its low cost and environmental friendliness [3, 4]. Microorganisms in oil reservoirs utilise hydrocarbon as a source of carbon and energy, which affects the quality of oil [5]. The application of MEOR in China is more frequent in areas with better physical properties rather than low-permeability oilfields [6–8].

Obtaining strains that produce metabolites with high efficiency and high tolerance is crucial for the application of MEOR. The previous work on the MEOR process has indicated that microbes enhance the properties of crude oil in two key ways. On the one hand, microorganisms can break down macromolecular hydrocarbons (such as long-chain hydrocarbons and aromatic hydrocarbons) into smaller molecules through degradation, which reduces the absolute viscosity of crude oil and increase fluidity [9, 10]. Dai et al. [11] obtained oil-degrading bacteria (Bacillus sp., Brevibacillus sp., and Acinetobacter sp.) that can degrade bio-refractory hydrocarbons in heavy oil by synergistic metabolism. Another study reported that a strain Ochrobactrum anthropi, screened from the sea bottom sediments in China, has the ability to degrade crude oil. The degradation rate of crude oil can reach 58.25% under the optimal growth conditions [12]. On the other hand, some bacteria, such as Bacillus sp., Pseudomonas sp., Rhodococcus sp., Yeasts (Candida sp.), and Acinetobacter sp., can produce biosurfactant (including glycolipids, lipopeptides, and phospholipids) that can reduce interfacial tension and emulsify the crude oil to increase fluidity [13–15]. Sharma et al. [16] screened a strain of Pseudomonas aeruginosa that produces rhamnolipid, which can reduce the surface tension of medium from 71.80 to 23.76 mN/m and show immense hydrocarbons emulsification capacity (50–60%). Huang et al. [17] also found that biosurfactant-producing bacteria (Serratia marcescens) can treat fracturing flowback fluids.

The work presented in this paper focuses on the screening and assessment of the biosurfactant-producing and viscosity-reducing bacteria in low-permeability oilfields in the Ordos Basin. The dominating bacteria that can thrive when using crude oil as the only carbon source are identified through a series of screening experiments. The performance of the strains was evaluated by the analysis of change in crude oil composition, viscosity, and the tolerance (temperature, salinity, and pH). The strains were identified by 16S rRNA sequencing and characterized through SEM.

2. Materials and Methods

2.1. Samples Collection and Media

Crude oil and injection waters samples were obtained from Hujianshan oil field (36°49-37°53N, 107°35-108°22E), west of the Ordos Basin, China [18]. Oil samples came from different layers in different blocks. Both came from the Chang layer in 154 Block and the Chang 6 layer in Zhuanjing Block. Both oil-bearing layers belong to the Triassic and are typical low-permeability reservoirs. The water sample was collected from Chang reservoir. Table 1 provides the essential information on the geological and geochemical factors of the two blocks.

Three culture media were used in the experiments. To enrich and separate the strains in oil and water samples, nutrient broth (NB) (g/L, beef extract 3.6; peptone 10; NaCl 5.6, addition 20 agar for solid NB) was used. The minimal salt medium (MSM) (g/L, NaNO₃ 1.5; (NH₄)₂SO₄ 1.5; K₂HPO₄ 1; MgSO₄ 0.5; KCl 0.5; CaCl₂ 0.002; FeSO₄ 0.001) was used for biodegradation test. Crude oil as carbon source was added separately. Blood agar plates are LB supplemented with 5% (w/v) sheep blood. Prior to usage, all media were autoclaved at 120°C for 20 or 40 min (for crude oil). To prevent precipitation of MSM, reagents must be sterilized separately and maxed at a lower temperature.

2.2. Isolation of Strains

2.2.1. Enrichment and Purification of Strains

Unless otherwise specified, all experimental procedures were carried out on the ultraclean workbench to ensure sterility. In order to enrich the dominating bacteria, five milliliters oil and water samples were added in NB media (100 mL), respectively, and cultured at 42°C with 160 rpm for four days. Then, two milliliters of culture medium were transferred to fresh medium for recultivation. Repeat the previous procedure three times. Additionally, ten milliliters oil and water samples were added to 100 mL of MSM, respectively, to screen strains that can use crude oil as the only carbon source. The enrichment method was consistent with the above. On NB agar plates, the enriched solution was plated after being diluted with sterile water (10^-1-10^-6). Colonies of bacteria were isolated based on color and morphology, then purified by streaking then three times on plates. The purified strain was inoculated into NB medium for enrichment, then mixed with 50% glycerol, and kept at -20°C.

2.2.2. Screening of Bacteria Using Oil as the Sole Carbon Source

The strains selected in the above experiment were inoculated on MSM, incubated at 42°C with 160 rpm for seven days, and the turbidity of the medium was observed.

2.2.3. Growth Monitoring (as Optical Density)

The strains obtained in Section 2.2.1 were inoculated in NB medium, and the optical density (OD₆₀₀) was measured using UV-vis spectrophotometry (Spectrumlab 752pro, USA) by taking 3 mL of solution at regular interval. The growth curves of the strains were obtained with time as the abscissa and OD₆₀₀ as the ordinate [12].

2.3. Screening of Biosurfactant-Producing Bacteria

2.3.1. Emulsification Rate for 24 Hours Emulsification Index

Three milliliters of n-hexane and three milliliters cell-free supernatant (8000 rpm, 10 min) were vortexed for two minutes to mix. The height of emulsified layer was measured immediately and again after 24 hours. The results were calculated as deviation The was calculated by the following formula [17]:

2.3.2. Hemolysis Assay

The conserved strains were inoculated on NB plates and cultivated for two days to obtain moderate colonies. The colonies were selected using inoculation loop in the center and inoculated on the blood plates, and then incubated for 72 h at 42°C. After that, the clearing zone was measured and its hemolytic activity was evaluated. Hemolytic activity was assessed based on the halo diameter: (-) no halo, (+) complete hemolysis with diameter of <1 cm, (++) complete hemolysis with diameter of >1 cm but <3 cm, and (+++) hemolysis with diameter of >3 cm [19].

2.3.3. Extraction of Biosurfactant

Six strains (A-3, SC4542, SC4534(2), H-1, SC4561, and SC4551) with superior hemolysis and emulsification rate had biosurfactants extracted and identified. A single strain was inoculated on 100 mL of medium and fermented for 48 h at 160 rpm and 45°C. Then, 50 mL of fermentation broth was centrifuged for 30 min at 8000 rpm and the pH of the supernatant was adjusted to 2.0 with hydrochloric acid. Finally, the supernatant was kept at 4°C overnight. Chloroform: methanol was used in a 2 : 1 ratio for liquid-liquid extraction. The mixture was magnetically stirred for 1 hour and then kept aside for 30 minutes. The lower organic phase was separated and evaporated at room temperature (about 20°C) in a ventilated area to obtain a biosurfactant [20, 21].

2.3.4. Thin Layer Chromatography

The composition of biosurfactants was identified by thin layer chromatography (TLC). Chloroform: methanol (1 : 1 v/v) was used as developing agent (80 mL), and silica plate (MACHEREY-NAGEL, Germany) was used for the experiment. Following are the standard sample and color developing agent: (1)To determine the presence of lipopeptides, 0.5% ninhydrin reagent was used as the indicator. If it showed purplish red, lipopeptides was present(2)To determine the presence of glycan, 500 μL of phenol and 1 mL concentrated sulfuric acid were diluted in 20 mL of ethanol as a chromogenic agent. Rhamnolipid was used as control. If it appeared brownish black, glycan was present(3)Iodine fumes (volatilizing iodine in a sealed beaker) were used for lipid detection. If it showed yellow, lipid was present

The sample should be fully dried and sprayed with color developing agent, and then heated in the oven for 5 min at 100°C for lipopeptide and 90°C for glycolipids to show the color.

2.3.5. FT-IR Spectrometric Analysis

The biosurfactants obtained in Section 2.3.4 were dried by vacuum freezing dryer (BiLon FD80A, China). The pellets were scanned on a FT-IR (Fourier Transform Infrared) spectrophotometer (Shimadzu IRAffinity-1S, Japan) over a range of 4000-0 cm^-1.

2.4. Temperature, Salinity, and pH Sensitivity Tests

The biosurfactant-producing strains, screened in Section 2.3, were inoculated at 160 rpm for three days in NB medium. The temperatures were between 25°C and 65°C, with a step of 10°C. A series of tests at 50°C was also added in response to the experimental results.

To assess the salinity sensitivity of strains, the same experiments were also carried out at 42°C with different NaCl concentration (1, 3, 5, 7, 9, 10, 20, 30, and 50 g/L). The growth of strains was examined via OD₆₀₀, obtained through UV-vis spectrophotometry (Spectrumlab 752pro, USA) [22].

Additionally, the pH sensitivity test was also carried out at fixed temperature of 42°C and NaCl concentration of 7 g/L. The pH was adjusted with HCl (1 mol/L) and NaOH (1 mol/L). After 3 days of incubation, the growth was checked with a pH range of 4 to 10.

2.5. The Effect of Dominant Bacteria on Crude Oil

2.5.1. Surface Tension

The biosurfactants-producing strains selected in Section were inoculated on NB medium for fermentation (50 mL) and the fermentation broth was centrifuged at 6000 rpm for five minutes after 7 days of incubation. The surface tension of the fermentation broth was measured using a surface tension meter (POWEREACH, China). The results were calculated as deviation.

2.5.2. Viscosity

Ten milliliters of sterile oil and five milliliters of strains solution were added in 100 mL of MSM and inoculated at 160 rpm, 42°C for 7 days and 14 days. After incubation, the crude oil was transferred to a centrifuge tube (three parallel samples for each strain), which was then rest at 42°C overnight to allow oil and water to completely separate. The medium without bacteria was as control. The change of crude oil viscosity before and after the action of the strains was measured by a rotational rheometer (Anton Paar MCR 302, Austria). The results were calculated as deviation. The viscosity reduction ratio is calculated by the following formula:

is the viscosity of control (mP·s); is the viscosity of the oil after the action of the strains.

2.5.3. GC-MS Analysis of the Degradation Effect of Strains

Fifty milliliter MSM with five milliliters of sterile oil and two milliliters of strains solution were inoculated at 160 rpm, 42°C for 7 days. After that, the crude oil was extracted with n-hexane after the culture broth had been centrifuged to remove bacteria and impurities [23]. The components of crude oil were determined by GC-MS (Thermo Fisher ISQ7000, USA). Helium was used as carrier gas with a flow rate of 1 mL/min. The heating program was set as follows. The initial temperature was 50°C with a hold time of 1 min. The temperature was increased to 120°C at 20°C/min and then increased to 250°C at 4°C/min. Finally, the temperature was increased to 300°C at 6°C/min with a hold time of 30 min. MS condition ionization method: EI, 70 eV; filament current, 100 A; multiplier voltage, 1200 V. Data collection method: selective ion scan (85, 123, 191, and 217). The degradation ratio of different components is calculated by the following formula:

is the sum of the peak areas of different components in the control group; is the sum of the peak areas of different components of strains.

2.6. Bacteria Identification

2.6.1. Morphological Features

The strain was streaked on NB media to obtain a single colony, and the bacterial morphology was observed by Scanning Electron Microscope (SEM).

2.6.2. 16S rRNA Identification of Dominant Bacteria

The 16S rRNA gene sequencing analysis was used to identify these strains. The primers 27F (5 AGAGTTTGATCCTGGCTCAG 3) and 1492R (5 GGTTACCTTGTTACGACTT 3) were used for PCR. The sequence was compared to the 16S rRNA nucleotide sequences at National Center for Biotechnology Information (NCBI; http://www.ncbi.nlm.nih.gov) [24].

3. Results

3.1. Screening and Isolation of Bacteria

3.1.1. Bacteria Using Oil as Sole Carbon Source

70 strains were obtained from two kinds of samples after months of screening and purification. Detailed information is shown in Table 2. All strains were then monitored for growth. Fast-growing strains can shorten the cultivation time and reduce the time cost. During this process, it was found that about 20 strains that were screened and preserved for the first time could not be rejuvenated successfully; hence, they were not used in the subsequent test. The growth curves are shown in S2, and 27 strains with fast growth rates are shown in Table 3.

When the bacteria can survive on crude oil as the only source of carbon, they require fewer additional nutrients and are more tolerable. This property is crucial for reducing costs and improving the efficacy of microbial flooding in the field. The fast-growing strains were inoculated into MSM and a total of 14 strains that could turn the medium turbid quickly (Table 4).

3.1.2. Biosurfactant-Producing Bacteria

Erythrocyte-lysing capabilities of biosurfactant-producing strains can cause clearing zones around strains colonies [25]. According to hemolysis and E₂₄, eight of the 14 strains screened from MSM have the ability to produce biosurfactants (Table 4). SC4561, SC4534(2), SC4551, and SC4542 showed great biosurfactant-producing ability, shown in Figure 1.

3.2. Characterization of Biosurfactants

3.2.1. TLC

The experimental results of thin layer chromatography are shown in Figure 2. Five strains A-3, SC4542, SC4534(2), H-1, and SC4551 exhibited clear purple red, demonstrating the presence of lipopeptide (Figure 2(a)). Two strains SC4542 and SC4534(2) produced very light brown spots in Figure 2(b), while the other strains produced obvious brown-black spots at the front of the developing agent, but the color was also lighter than standard rhamnolipids, indicating that little glycan were present. The lipid reaction (Figure 2(c)) showed that all strains had obvious yellow bands except. In general, the 6 strains may produce lipopeptides and lipid biosurfactants.

(a)

(b)

(c)

3.2.2. FT-IR

Figure 3 displays the FT-IR results, which were of two different types. First, all the tested have an obvious absorption peak at 1637.56 cm^-1, which is the evidence of the existence of amide group (H₂N-C=O), indicating that all the strains produced lipid [26]. In Figure 3(a), absorption peaks for the O-H stringing vibration at 3400-3200 cm^-1 and the absorption peaks at 1193-1226 and 1082-1078 cm^-1 were characteristic of pyranose [27], indicating that SC4534 (2), SC4542, and SC461 strains produce glycolipid. However, in Figures 3(b), C-H stretching vibration peak at 2850-2950 cm^-1, without obvious O-H absorption peak, and absorption peaks at 1458.18 cm^-1 are caused by C-H on the aliphatic peptide chain [20, 21], indicating that A-3, H-1, and SC4551 may produce lipopeptide. Therefore, the biosurfactant produced by SC4534(2), SC4542, and SC4561 was mainly glycolipid, and A-3, H-1, and SC4551 produced lipopeptide, which was basically consistent with the TLC results.

(a)

(b)

3.3. Growth in Different Temperatures, Salinity, and pH

The reservoir is an extreme environment (high temperature, anaerobic conditions, high salinity, high pressure, etc.), which is not conducive to the survival of microorganisms. The dominant bacteria that can be applied to MEOR must be able to adapt to this harsh environment.

Figure 4 displays the results of the sensitivity test on JSC4535 and JSC4501 strains. Both strains were screened by MSM. Temperature sensitivity tests show that all strains can grow fast between 25 and 50°C, with 35°C being the optimal temperature for the strain was. The growth decreased rapidly at 50°C. The optimal growth salinity of all strains was 10 g/L and JSC4535 can also survive under 50 g/L. All strains thrived when pH was over 7 shows that the screened bacteria have strong alkaline tolerance.

Figure 5 shows the result of 4 strains screening from water sample in Chang layer. The optimal growth temperature of SC4551 was 35°C-45°C. The ideal salinity was 10 g/L. The fastest growth rate was got at . The growth of strain SC4561 decreased with temperature, and it grew well at temperatures below 45°C. When the salinity was 50 g/L, the strain hardly survived, and the optimal salinity was 3 g/L. The strain has best optical density under . SC4534(2) had the best growth temperature at 45°C and 10 g/L of salinity. The concentration of the bacterial solution was high at pH upon 5. The results of SC4542 strain were special, the OD₆₀₀ of the bacterial solution is relatively small in all test. The ideal temperature was 35°C and the best pH was 8. When the salinity is 10 g/L, the bacterium survived best.

The optimum growth temperature for H-1 was 35°C, and at 50°C, the OD₆₀₀ value fell sharply. The optimal salinity was 3 g/L. A-3 have the best growth under 35°C and . The best salinity is 7 g/L (Figure 6).

There are some anomalies in the sensitivity test. Some strains, as SC4551, SC4534(2), and JSC4501, would exhibit higher OD at high temperatures than low temperatures. The OD value of the SC4542 strain drops sharply at the salinity of 30 g/L, which may due to that the strain concentrate on the surface of the medium to form a film rather than dispersing in the medium (Figure 7(a)). The OD₆₀₀ of H-1 altered dramatically at , and the curve fluctuated significantly. This is primarily because the state of the strain was completely different under the two pH conditions (Figure 7(b)).

(a)

(b)

3.4. Biodegradation of Crude Oil

3.4.1. Changes of Surface Tension

The results of surface tension measurement of fermentation broth showed that the highest reduction in surface tension was from 58.37 mN/m to 40.51 mN/m (Table 5). Four strains, A-3, H-1, SC4534(2), and SC4561, exhibited more obvious effect in reducing surface tension, while other two strains, JSC4501 and JSC4535, had poor effects on the surface tension of crude oil or fermentation broth and even caused the surface tension to increase.

3.4.2. Viscosity Reduction Ratio

Figure 8 depicts the effects of the strains on the viscosity of crude oil. All strains but SC4542 had viscosity decreased by 27-51% after 7 days of incubation (Figure 8(a)) and had viscosity decreased by 27-47% after 14 days of incubation (expect for SC4534(2)) (Figure 8(b)). Overall, the viscosity reduction rate did not increase with increasing incubation time; on the contrary, some strains, including SC4534(2), SC4551, and SC4561, had the drop in the rate of viscosity reduction. Strains SC4542 and JSC4535 had a longer period of action, the viscosity reduction of 7 days incubation (5.71% and 38.66%, respectively) is less that of 14 days (32.59% and 47.2%, respectively).

(a)

(b)

3.4.3. GC-MS Analysis

Through the analysis of the crude oil components by GC-MS before and after the action of the strain, long-chain n-alkanes were more effectively degraded by A-3, SC4534(2), SC4561, SC4551, and JSC4535 (Figure 9(a) and 9(b)), and A-3 had the best effects. The degradation rates of n-alkanes by these strains were 51.2%, 28.3%, 35.2%, 5.45%, and 28.9%, respectively. At the same time, they also had a slight degradation effect on cholestane () (Figure 9(b)). Strains JSC4501, SC4542, and H-1 only had a little degradation effect on short-chain alkanes (Figure 10(a)) but they can degrade tricyclic terpenes () (Figure 10(b)) and SC4542 has the best effect.

(a)

(b)

(a)

(b)

Seven strains had a good degradation effect on aromatic hydrocarbons, methylnaphthalene, and ethyl (Figure 11). The JSC4501, JSC4535, SC4542, SC4551, SC4561, A-3, and SC4534(2) all had degradation rate of 90.8%, 90.6%, 87.2%, 85.9%, 85.7%, 85.3%, and 84.7%, respectively. In addition, the strain SC4561, SC4534(2), A-3, and JSC4501 also slightly degraded methyl chrysene, though less than that of naphthalene.

3.5. Identification of Dominant Bacteria

The morphological characteristics and gene identification of different dominant bacteria are shown in Table 6. The species of SC4542 were identified through ANI (Average Nucleotide Identity) since it did not identify though 16S rRNA. Six of seven strains were Bacillus, and one belonged to Alphaproteobacteria (JSC4535). SEM showed the morphological characteristics of eight strains (Figure 12). All strains were rod-shaped but had different morphologies. JSC4535, SC4542, and SC4561 were elongated with aspect ratios ranging from 5 : 1 to 9 : 1. While H-1, SC4534(2) were stubby, with an aspect ratio of almost 2 : 1.

4. Discussion

4.1. The Nature of the Dominant Bacteria and Their Adaptations

Eight effective strains that can change the properties of crude oil have been obtained from the produced water and crude oil of Hujianshan oilfield, a low-permeability oilfield in the Ordos Basin, through separation and screening. According to the16S rRNA analysis, seven strains belong to Bacillus. Oil wells frequently include the dominant bacterium Bacillus, which has been identified in many studies on the community structure of oil wells [28–30]. Bacillus has strong environmental adaptability due to its endospores. It has been employed in oil reservoir development, soil, and marine pollution remediation [11, 31]. The biosurfactants produced by the SC4534(2), SC4561, and SC4542 were lipopeptide and A-3, H-1, and SC4551 produced glycolipid. Biosurfactants are more friendly to the environment and less toxic compared with chemical synthesized surfactants [13, 17]. They are amphiphilic molecules and soluble in both nonpolar and polar compounds [26]. Therefore, they can spontaneously assemble at the oil-water interface to reduce surface/interfacial tension and emulsify crude oil [32]. Among them, lipopeptide including surfactin are considered to be more promising due to great surface activity [33, 34]. Bacillus sp. has been reported in numerous studies to be the main strain of lipopeptide producing bacteria [35–37].

A special phenomenon in the study is that 20 strains of the 70 strains obtained at the initial stage could not be revived. This might be the result of strains having limited cultivability and surviving in extreme environments (oil well environments are extreme with unique biomes) [15, 38]. Culture-dependent approaches might not suitable for these reservoir species.

The temperature and salinity sensitivity tests show that strains have a wide range of optimal growth temperatures and salinity. They can multiply quickly in the range of 25°C-50°C, and had the best growth rate at 35°C-40°C. Additionally, they also exhibited good action in culture medium with salinity under 40 g/L. Some strains can survive at salinity 50 g/L (JSC4535, SC4542, and A-3). The strains obtained in this study are more broadly adapted than those reported in Zhao et al. [39] in another oilfield in the Ordos Basin. The temperature of the oil well often changes with the exploitation method and it controls the growth of microorganisms and may inhibit the enzyme expression and activity within the optimum range [22, 40]. The temperature of the sampling well after water flooding ranges between 40 and 50°C. The salinity of the reservoir is 37-46 g/L, and the salinity will also decrease significantly after water flooding. The results indicate that these biosurfactant-producing strains have good adaptability to well conditions. The pH tolerance test showed that the eight strains screened did not produce organic acids, but could survive in strong alkaline environments. The alkali-tolerant strains are better adapted to the environment since the study area is heavily mineralized and the water drive will raise the pH of the well [41].

Noteworthy phenomena were shown in sensitivity test. OD₆₀₀ value changed nonlinearly, dropping suddenly (such as SC4542 and H-1). In addition, OD at 55°C was higher than 50°C in JSC4501, SC4551, and SC4534(2). We have two speculations. First, the optional density (OD₆₀₀) was used to measure the concentration of the bacterial solution because that this method is suitable for measuring a large number of cultures, and is more accurate for homogeneous bacterial solutions [42, 43] However, these screening strains are aerobic bacteria which can easily live in contact with the air on the surface of the culture medium and whose solutes are not homogeneous (Figure 7), thus the OD₆₀₀ value is low. Second, although 1 mL bacterial solution were added to the fresh medium at the beginning of the experiment, the concentration of 1 mL solution (OD₆₀₀) was not completely consistent from transfer to transfer. When the strain multiplies a lot, the effect of the transferred solution is less, but the above phenomenon occurs at higher temperatures and salinity, where the strain multiplies less and slowly, and the influence of the 1 mL transferred solution is reflected. Furthermore, the relationship between salinity and the amount of dissolved oxygen is generally negative [44]. High salinity will inhibit growth of aerobic bacteria. Attention should be paid to the supply of oxygen in MEOR applications.

4.2. Effects of Dominant Strains on Crude Oil

In the biodegradation test, crude oil viscosity is reduced by 27-51% after 7 days of incubation, but prolonged incubation time may make the strain compete for nutrients and produce toxins that have a counter impact on viscosity (for example, SC4534(2), SC4551, and SC4561). The change of can reveal the priority of the strain for the utilization of n-alkanes [45]. The of A-3, SC4534(2), SC4561, JSC4535, and SC4551 rise from 1.29 before action to 1.77, 2.04, 1.61, 1.52, and 1.48, respectively, while the value of JSC4501, SC4542, and H-1 decrease to 1.18, 1.03, and 1.17, respectively. The results indicate that the strains A-3, SC4534(2), SC4561, JSC4535, and SC4551 may grow on long-chain alkanes () preferentially, making increased content of short-chain alkanes (Figure 6), but the content of long-chain alkanes increased after the action of JSC4501, SC4542, and H-1. It is possible that the content increases due to the degradation of short-chain hydrocarbons and the action on cycloalkanes [46].

5. Conclusion and Future Work

In the present work, six Bacillus and one Tistrella mobilis were isolated from low-permeability oil fields. They had a great growth rate on crude oil as the sole carbon source and exhibited high stability over a wide range of temperature, salinity, and pH than other strains. By biodegrading the heavier components of the crude oil (long-chain n-alkanes and aromatics) and emulsifying the crude oil through biosurfactants, these eight strains could improve flowability and reduce oil viscosity. The results in the study demonstrated the presence of high-efficiency biosurfactant-producing strains and viscosity-reducing bacteria in low-permeability oilfields. Under the combined effect of emulsification and viscosity reduction, the condition and properties of crude oil were improved, but the culture time of the strains should not be too long and the attention should be paid to the supply of oxygen, which is important for the application of MEOR in low permeability oil fields. Moreover, since the strains screened have different effects on different components in crude oil, the research on the compound use of strains will also be very important.

Data Availability

The geological and geochemical data used to support the findings of this study are included within the article.

Conflicts of Interest

The authors declared that they have no conflicts of interest in this work. We declare that we do not have any commercial or associative interest that represents a conflict of interest in connection with the work submitted.

Authors’ Contributions

Bian Ziwei worked on the conceptualization, formal analysis, methodology, visualization, and in writing the review and editing. Wu Hanning and Wu Yifei were assigned on the conceptualization, project administration, funding acquisition, and in writing the review and editing. Wei Lusha was tasked on the investigation and funding acquisition. Zhi Zena was responsible on the investigation and methodology.

Acknowledgments

The authors thank Dr. Huang Wenqi for her help and advice in figure revision. This research was partially supported by the grants from the National Natural Science Foundation of China (Nos. 91855211 and 41802164), the Key R&D Program Projects in Shaanxi Province (No. 2019NY-139), the Basic Research Program of Natural Science of Shaanxi Province (No. 2019JQ-717), and the Open Project Fund of the State Key Laboratory of Continental Dynamics, Northwestern University (No. 21LCD07).

Supplementary Materials

Supplementary 1. S1 Graphical Abstract: viscosity-reducing and biosurfactant-producing bacteria with crude oil as the sole carbon source were screened, characterized, and identified.

Supplementary 2. S2 Growth Curves of Strains: (a) Chang 6 layer strains (oil sample); (b) strains using oil as sole carbon source; (c) Chang layer strains (oil samples); (d) Chang layer strains (water samples)).

References

X. Z. Wang, H. Yang, W. Wang, J. Li, and Q. S. Liang, “Technical advancements in enhanced oil recovery in low permeability reservoirs of Yanchang oilfield,” Petroleum Geology and Recovery Efficiency, vol. 29, no. 4, pp. 69–75, 2022.
View at: Google Scholar
W. R. Hu, Y. Wei, and J. W. Bao, “Development of the theory and technology for low permeability reservoirs in China,” Petroleum Exploration and Development, vol. 45, no. 4, pp. 646–656, 2018.
View at: Google Scholar
J. J. Niu, Q. Liu, J. Lv, and B. Peng, “Review on microbial enhanced oil recovery: mechanisms, modeling and field trials,” Journal of Petroleum Science and Engineering, vol. 192, article 107350, 2020.
View at: Publisher Site | Google Scholar
M. Safdel, M. A. Anbaz, A. Daryasafar, and M. Jamialahmadi, “Microbial enhanced oil recovery, a critical review on worldwide implemented field trials in different countries,” Renewable and Sustainable Energy Reviews, vol. 74, pp. 159–172, 2017.
View at: Publisher Site | Google Scholar
Z. Zhou, C. Zhang, P. Liu et al., “Non-syntrophic methanogenic hydrocarbon degradation by an archaeal species,” Nature, vol. 601, no. 7892, pp. 257–262, 2022.
View at: Publisher Site | Google Scholar
T. N. Nazina, Q. Feng, N. K. Kostryukova et al., “Microbiological and production characteristics of the dagang high-temperature heavy oil reservoir (block no. 1) during trials of the biotechnology for enhanced oil recovery,” Microbiology, vol. 86, no. 5, pp. 653–665, 2017.
View at: Publisher Site | Google Scholar
J. Zhuang, C. Y. Lu, W. J. Yang, and W. B. Yuan, “Mechanism and community distribution of microbially activated water flooding in Sai 169 low-permeability reservoir,” Special Oil & Gas Reservoirs, vol. 29, no. 1, pp. 147–153, 2022.
View at: Google Scholar
C. A. Du, Y. T. Song, Z. Yao, W. L. Su, G. Zhang, and X. L. Wu, “Developments in in-situ microbial enhanced oil recovery in Shengli oilfield,” Energy Sources, Part A: Recovery, Utilization, and Environmental Effects, vol. 44, no. 1, pp. 1977–1987, 2022.
View at: Publisher Site | Google Scholar
T. Ma and Y. Chen, “Metabolism characteristics of microorganisms in oil reservoir and microbial enhanced oil recovery,” Journal of Microbiology, vol. 38, no. 3, 2018.
View at: Google Scholar
Y. Yu, Q. Liu, B. Peng, and J. Lv, “A review of the biodegradation of asphaltene in heavy oil,” Chemical Industry and Engineering Progress, vol. 40, no. 3, pp. 1574–1585, 2020.
View at: Google Scholar
X. Dai, J. Lv, S. Guo, and W. Wei, “Heavy oil biodegradation by mixed bacterial consortium of biosurfactant-producing and heavy oil-degrading bacteria,” Polish Journal of Environmental Studies, vol. 30, no. 1, pp. 71–80, 2021.
View at: Publisher Site | Google Scholar
Y. L. Chen, Q. Liu, J. C. Yu, and C. Chen, “Isolation and identification of marine petroleum degradable bacterium AH07 and its degradation performance characteristics,” Journal of Microbiology, vol. 40, no. 1, pp. 32–36, 2020.
View at: Google Scholar
S. J. Geetha, I. M. Banat, and S. J. Joshi, “Biosurfactants: production and potential applications in microbial enhanced oil recovery (MEOR),” Biocatalysis and Agricultural Biotechnology, vol. 14, pp. 23–32, 2018.
View at: Publisher Site | Google Scholar
T. Gutierrez and C. Nikolova, “Use of microorganisms in the recovery of oil from recalcitrant oil reservoirs: current state of knowledge, technological advances and future perspectives,” Frontiers in Microbiology, vol. 10, 2020.
View at: Publisher Site | Google Scholar
M. Rani, J. T. Weadge, and S. Jabaji, “Isolation and characterization of biosurfactant-producing bacteria from oil well batteries with antimicrobial activities against food-borne and plant pathogens,” Frontiers in Microbiology, vol. 11, p. 64, 2020.
View at: Publisher Site | Google Scholar
R. Sharma, J. Singh, and N. Verma, “Optimization of rhamnolipid production from Pseudomonas aeruginosa PBS towards application for microbial enhanced oil recovery,” 3 biotech, vol. 8, 2018.
View at: Publisher Site | Google Scholar
Y. Huang, H. H. Zhou, G. Zheng et al., “Isolation and characterization of biosurfactant-producing Serratia marcescens ZCF25 from oil sludge and application to bioremediation,” Environmental Science and Pollution Research, vol. 27, no. 22, pp. 27762–27772, 2020.
View at: Publisher Site | Google Scholar
Z. M. Zhao, A Study on Heterorgeneities and Development Characteristics of Chang 4+5 and Chang 6 Reservoirs in Hujianshan Area, Xi'AN: Xi'AN SHIYOU UNIVERSITY, 2018.
S. H. Goodman, Investigation into the potential application of microbial enhanced oil recovery on unconventional oil: a field specific approach, University of Liverpool, 2017.
J. Sharma, A. Kapley, D. Sundar, and P. Srivastava, “Characterization of a potent biosurfactant produced from _Franconibacter_ sp. IITDAS19 and its application in enhanced oil recovery,” Colloids and Surfaces B: Biointerfaces, vol. 214, article 112453, 2022.
View at: Publisher Site | Google Scholar
M. Kong, X. J. Xing, Q. Jiang, M. G. Peng, J. Wang, and W. Y. Zhang, “Screening and petroleum hydrocarbon degradation characteristics of petroleum degradation bacteria producing surfactant,” Journal of Civiland Environmental Engineering, vol. 44, no. 4, pp. 149–156, 2022.
View at: Google Scholar
J. J. Ren, Z. Z. Wang, D. Z. Niu et al., “Isolation and characterization of the novel oil-degrading strain Kosakonia cowanii IUMR B67 and expression of the degradation enzyme,” FEMS Microbiology Letters, vol. 367, no. 7, 2020.
View at: Publisher Site | Google Scholar
X. Y. He, L. G. Xue, X. Wang et al., “Study on degradation characteristics and optimizing conditions of crude oil degrading bacteria HC13,” Journal of Lanzhou Jiaotong University, vol. 38, no. 1, pp. 127–133, 2019.
View at: Google Scholar
S. Nimrat, S. Lookchan, T. Boonthai, and V. Vuthiphandchai, “Isolation, optimisation and gasoline biodegradation by lipopeptide-producing Bacillus subtilis SE1,” Science Asia, vol. 46, no. 2, p. 195, 2020.
View at: Publisher Site | Google Scholar
M. Manaargadoo-Catin, A. Ali-Cherif, J. L. Pougnas, and C. Perrin, “Hemolysis by surfactants-a review,” Advances in Colloid and and Interface Science, vol. 228, pp. 1–16, 2015.
View at: Publisher Site | Google Scholar
N. Sakthipriya, G. Kumar, A. Agrawal, M. Doble, and J. S. Sangwai, “Impact of biosurfactants, surfactin, and rhamnolipid produced fromBacillus subtilisandPseudomonas aeruginosa, on the enhanced recovery of crude oil and its comparison with commercial surfactants,” Energy & Fuels, vol. 35, no. 12, pp. 9883–9893, 2021.
View at: Publisher Site | Google Scholar
W. Q. Huang, M. W. Zhao, X. Y. Wang et al., “Revisiting the structure of arabinogalactan from _Lycium barbarum_ and the impact of its side chain on anti-ageing activity,” Carbohydrate Polymers, vol. 286, article 119282, 2022.
View at: Publisher Site | Google Scholar
P. K. Gao, H. M. Tian, Y. S. Wang et al., “Spatial isolation and environmental factors drive distinct bacterial and archaeal communities in different types of petroleum reservoirs in China,” Scientific Reports, vol. 6, no. 1, 2016.
View at: Publisher Site | Google Scholar
A. Amin, K. Ali Reza, H. Rohallah, and M. Jazini, “Experimental study of microbial enhanced oil recovery in oil-wet fractured porous media,” Oil & Gas Science and Technology – Revue d’IFP Energies nouvelles, vol. 73, 2020.
View at: Publisher Site | Google Scholar
I. J. B. Durval, A. H. M. Resende, M. A. Figueiredo, J. M. Luna, R. D. Rufino, and L. A. Sarubbo, “Studies on biosurfactants produced using Bacillus cereus isolated from seawater with biotechnological potential for marine oil-spill bioremediation,” Journal of Surfactants and Detergents, vol. 22, no. 2, pp. 349–363, 2019.
View at: Publisher Site | Google Scholar
N. Sakthipriya, M. Doble, and J. S. Sangwai, “Efficacy ofBacillus subtilisfor the biodegradation and viscosity reduction of waxy crude oil for enhanced oil recovery from mature reservoirs,” Energy sources. Part A, Recovery, utilization, and environmental effects, vol. 38, no. 16, pp. 2327–2335, 2016.
View at: Publisher Site | Google Scholar
J. F. Liu, S. M. Mbadinga, S. Z. Yang, J. D. Gu, and B. Z. Mu, “Chemical structure, property and potential applications of biosurfactants produced by Bacillus subtilis in petroleum recovery and spill mitigation,” International Journal of Molecular Sciences, vol. 16, no. 3, pp. 4814–4837, 2015.
View at: Publisher Site | Google Scholar
P. Datta, P. Tiwari, and L. M. Pandey, “Isolation and characterization of biosurfactant producing and oil degrading _Bacillus subtilis_ MG495086 from formation water of Assam oil reservoir and its suitability for enhanced oil recovery,” Bioresource Technology, vol. 270, pp. 439–448, 2018.
View at: Publisher Site | Google Scholar
X. Wang, B. Liu, X. Li et al., “Biosurfactants produced by novel facultative-halophilic _Bacillus_ sp. XT-2 with biodegradation of long chain n-alkane and the application for enhancing waxy oil recovery,” Energy, vol. 240, article 122802, 2022.
View at: Publisher Site | Google Scholar
A. Nayarisseri, P. Singh, and S. K. Singh, “Screening, isolation and characterization of biosurfactant-producing bacillus tequilensis strain ANSKLAB04 from brackish river water,” International journal of Environmental Science and Technology, vol. 16, no. 11, pp. 7103–7112, 2019.
View at: Publisher Site | Google Scholar
P. Guo, F. Yang, S. Ye, J. Li, F. Shen, and Y. Ding, “Characterization of lipopeptide produced by Bacillus altitudinis Q7 and inhibitory effect on Alternaria alternata,” Journal of Basic Microbiology, 2022.
View at: Publisher Site | Google Scholar
V. M. Alvarez, C. R. Guimarães, D. Jurelevicius et al., “Microbial enhanced oil recovery potential of surfactin-producing _Bacillus subtilis_ AB2.0,” Fuel, vol. 272, article 117730, 2020.
View at: Publisher Site | Google Scholar
K. M. Kaster, K. Bonaunet, H. Berland, G. Kjeilen-Eilertsen, and O. G. Brakstad, “Characterisation of culture-independent and -dependent microbial communities in a high-temperature offshore chalk petroleum reservoir,” Antonie Van Leeuwenhoek, vol. 96, no. 4, pp. 423–439, 2009.
View at: Publisher Site | Google Scholar
W. Zhao, J. Yang, X. L. Huang, X. A. Xiao, X. Y. Jin, and F. L. Chen, “Laboratory on enhancing oil recovery of Ansai low-permeability reservoir by microbial combination flooding process,” Xinjiang Petroleum Geology, vol. 35, no. 6, pp. 699–702, 2014.
View at: Google Scholar
Y. Tian, Y. Y. Wan, H. M. Mu, H. L. Dong, B. R. Briggs, and Z. H. Zhang, “Microbial diversity in high-temperature heavy oil reservoirs,” Geomicrobiology Journal, vol. 37, no. 1, pp. 59–66, 2020.
View at: Publisher Site | Google Scholar
C. Chen, Z. X. Dong, M. Q. Lin, and J. Yang, Chemical Mechanism of pH Increase in Sandstone during Low Salinity Waterflooding, Da Lian, Liao Ning Province, China, 2016.
M. Domańska, K. Hamal, B. Jasionowski, and J. Bomotowski, “Bacteriological contamination detection in water and wastewater samples using OD600,” Polish Journal of Environmental Studies, vol. 28, no. 6, pp. 4503–4509, 2019.
View at: Publisher Site | Google Scholar
K. O. Duedu and C. E. French, “Two-colour fluorescence fluorimetric analysis for direct quantification of bacteria and its application in monitoring bacterial growth in cellulose degradation systems,” Journal of Microbiological Methods, vol. 135, pp. 85–92, 2017.
View at: Publisher Site | Google Scholar
Z. Yu, Y. Zhang, M. X. Jiang, Z. H. Xiong, and H. Chen, “The effect of salinity on dissolved oxygen,” Scientific Consulting, vol. 3, pp. 39-40, 2014.
View at: Google Scholar
P. K. Gao, Y. S. Wang, H. Z. Zhang, X. X. Pan, G. Q. Li, and T. Ma, “Mechanism of crude oil viscosity reduction by two thermophilic hydrocarbon-degrading bacteria,” CIESC Journal, vol. 64, no. 11, pp. 4240–4245, 2013.
View at: Google Scholar
S. L. Yuan, Study on Oil Reservoir Microbial Strains Screening and their Characteristics, Xi'an Shiyou University, 2011.

Copyright

Copyright © 2023 Bian Ziwei et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies