Research Article
Methylation Pattern of the SOCS3 and IL6R Promoters in Rheumatoid Arthritis
Table 1
Characteristics of primers and amplicons.
| Gene | Primer name | Sequence 5′ ⟶ 3′ | Amplicon size [bp] | Amplicon location with reference to assembly GRCh38 [chromosome : start : end : strand] | Primer complementary to methylated/unmethylated sequences |
| ACT-B | ACTB sense | GGTGGTGATGGAGGAGGTTTAG | 115 | 7 : 5532117 : 5532232 : −1 | Independent of methylation status | ACTB antisense | CCCTTAAAAATTACAAAAACCACAACC |
| SOCS3 | SOCS3_ methyl_sense | GTGGAACGATGGTTTTAATTTACG | 126 | 17 : 78360912 : 78361038 : 1 | Methylated sequences | SOCS3_ methyl_antisense | ATTCCCGCAAATCCCTAACG | SOCS3_ unmethyl_sense | GGTGGAATGATGGTTTTAATTTATG | 127 | 17 : 78360911 : 78361038 : 1 | Unmethylated sequences | SOCS3_ unmethyl_antisense | ATTCCCACAAATCCCTAACATAC |
| IL6R | IL6R_ methyl_sense | CGTATTTTGGGACGGTTTAGAGAC | 91 | 1 : 154405299 : 154405390 : 1 | Methylated sequences | IL6R_ methyl_antisense | CACATAACTCAAAACGACGAACG | IL6R_ unmethyl_sense | TTGTATTTTGGGATGGTTTAGAGATG | 95 | 1 : 154405298 : 154405393 : 1 | Unmethylated sequences | IL6R_ unmethyl_antisense | TCACACATAACTCAAAACAACAAACAAT |
|
|
CpG sites in primer sequence are in bold. |