Research Article
Occurrence of Bordetella Infection in Pigs in Northern India
Table 3
Genus specific and species specific primers used in multiplex PCR for detection of Bordetella bronchiseptica.
| | Name of primers | Sequence 5′-3′ | Product length (bp) | References |
| | B688Bbalc-F | ACCAACCGCATTTATTCCTACTA | 324 | This study | | B1012Bbalc-R | GGCCCTGGAGTTCGTATTTATG |
| | 425BBfim-1 F | TGAACAATGGCGTGAAAGC | 425 |
Xin et al., 2008 [15] | | 425BBfim-2 R | TCGATAGTAGGACGGGAGGAT | | 237BBFla 4 F | TGGCGCCTGCCCTATC | 237 |
Hozbor et al., 1999 [14] | | 237BBFla 2 R | AGGCTCCCAAGAGAGAAA |
|
|
F: forward primer; R: reverse primer.
|