Research Article

Analysis of Amino Acid Changes in the Fusion Protein of Virulent Newcastle Disease Virus from Vaccinated Poultry in Nigerian Isolates

Table 8

Point mutation pattern along fusion protein of study isolates compared to reference LaSota strain KU665482.1.

ID virus isolateNucleotide at indicated position along the fusion gene
Cleavage siteFusion peptide

114115116117118121124135
Codon340–342343–345346–348349–351352–354361–363370–372403–405
KU665482.1 LaSota.71.IR/2016CAGGGCCGCCTTATAATTGGTATA
OK491971 Avian orthoavulavirus 1 isolate KN 14CGG (Q114R)AAG (G115K)CGT (R116)TTT (L117F)GTG (I118V)GTT (I121V)AGT (G124S)GTA (I135V)
OK491972 Avian orthoavulavirus 1 isolate KN 36CGG (Q114R)AAG (G115K)CGT (R116)TTT (L117F)GTG (I118V)GTT (I121V)AGT (G124S)GTA (I135V)
OK491973 Avian orthoavulavirus 1 isolate KN 48CGG (Q114R)AAA (G115K)CGT (R116)TTT (L117F)GTG (I118V)GTT (I121V)AGT (G124S)GTA (I135V)
OK491974 Avian orthoavulavirus 1 isolate KN 55CGG (Q114R)AAG (G115K)CGT (R116)TTT (L117F)GTG (I118V)GTT (I121V)AGT (G124S)GTA (I135V)
OK491975 Avian orthoavulavirus 1 isolate KN 56CGG (Q114R)AAG (G115K)CGT (R116)TTT (L117F)GTG (I118V)GTT (I121V)AGT (G124S)GTA (I135V)
OK491976 Avian orthoavulavirus 1 isolate KN 71CGG (Q114R)AAA (G115K)CGT (R116)TTT (L117F)GTA (I118V)GTT (I121V)AGT (G124S)GTA (I135V)
OK491977 Avian orthoavulavirus 1 isolate KN 75CGG (Q114R)AAG (G115K)CGT (R116)TTT (L117F)GTG (I118V)GTT (I121V)AGT (G124S)GTA (I135V)

Variable positions along functional sites in the fusion protein showing nucleotide substitution compared with LaSota KU665482.1 vaccine strain as reference. Not all substitution resulted in mutation because of degeneracy of amino acid. Italic positions show substitution site. Reference strain. Vaccine strain. Study isolates. A: adenine; G: guanine; C: cytosine; T: thymine.