Research Article

Analysis of Amino Acid Changes in the Fusion Protein of Virulent Newcastle Disease Virus from Vaccinated Poultry in Nigerian Isolates

Table 9

Point mutation pattern along fusion protein of study isolates compared to reference LaSota strain KU665482.1.

ID virus isolateNucleotide at indicated position along the fusion gene
HRaHRbConserved cysteine residue

145272278285288297394
Codon433–435814–816832–834862–864862–864889–8911180–1182
KU665482.1 LaSota.71.IR/2016AAAAACTCAATAACTAATTGC
OK491971 Avian orthoavulavirus 1 isolate KN 14AAC (K145N)TAC (N272Y)CCA (S278P)ATAAAA (T288N)AATTGC
OK491972 Avian orthoavulavirus 1 isolate KN 36AAC (K145N)TAC (N272Y)CCA (S278P)ATAAAA (T288N)AATTGC
OK491973 Avian orthoavulavirus 1 isolate KN 48AAC (K145N)TAC (N272Y)CCA (S278P)AAA (I285K)AAA (T288N)AAA (N297K)TGC
OK491974 Avian orthoavulavirus 1 isolate KN 55AAC (K145N)TAC (N272Y)CCA (S278P)ATAAAA (T288N)AATTGC
OK491975 Avian orthoavulavirus 1 isolate KN 56AAC (K145N)TAC (N272Y)CCA (S278P)AAA (I285K)AAA (T288N)AATTGC
OK491976 Avian orthoavulavirus 1 isolate KN 71AAC (K145N)TAC (N272Y)CCA (S278P)ATAAAA (T288N)AATTGC
OK491977 Avian orthoavulavirus 1 isolate KN 75AAC (K145N)TAC (N272Y)CCA (S278P)ATAAAA (T288N)AATTGT (C394S)

Variable positions along functional sites in the fusion protein showing nucleotide substitution compared with LaSota KU665482.1 vaccine strain as reference. Not all substitution resulted in mutation because of degeneracy nature of amino acid. Italic positions show substitution site. Reference strain. Vaccine strain. Study isolates. HR: heptad repeats; A: adenine; G: guanine; C: cytosine; T: thymine.