Research Article
Full-Length Genome Sequencing and Analysis of Hepatitis B Viruses Isolated from Iraqi Patients
Table 1
Primers used for amplification of the whole HBV genome.
| Primer | Sequence (5′–3′) | Genome Location | Region | Ta (°C) | Amplicon size (bp) | Reference |
| F1 | CATACTGCGGAACTCCTAGC | 1267–1286 | X | 61 | 681 | Current study | R1 | AGTAACTCCACAGTAGCTCC | 1947–1928 | F2 | GAGGCATACTTCAAAGACTG | 1698–1717 | PreC-C | 59 | 826 | R2 | GAGGGTTAAAGACAGGTACAG | 2523–2503 | F3 | GGAAGAGAAACGGTCATAGAG | 2231–2251 | P | 60 | 941 | R3 | GGCCTGAGGATGAGTGTTTC | 3171–3152 |
| F4 | ATGGGGCAGAATCTTTCC | 2848–2865 | PreS1-S | 59 | 1265 | [11] | R4 | CTGTATGATGTGATCTTGTGGC | 930–909 | Current study |
| F5 | ATGGAGAACATCACATCAGG | 155–174 | P1 | 60 | 1540 | [12] | R5 | GTCGGTCGTTGACATTACAG | 1694–1675 | Current study |
|
|
Consensus DNA sequence created from aligning of 1094 genome sequences of HBV genotype D isolates found in the HBVdb, Ta: annealing temperature. |