Research Article
Feeding Patterns and Xenomonitoring of Trypanosomes among Tsetse Flies around the Gashaka-Gumti National Park in Nigeria
Table 1
Primer names and sequences for the amplification of mitochondrial cytochrome b in tsetse blood meals [
16].
| Host | Primer | Sequence 5′-3′ | | Amplicon size |
| Human | Human741-F | GGCTTACTTCTCTTCATTCTCTCCT | 66.08 | 334 | Dog | Dog368F | GGAATTGTACTATTATTCGCAACCAT | 62.30 | 680 | Cattle | Cow121-F | CATCGGCACAAATTTAGTCG | 58.35 | 561 | Pig | Pig573-F | TTAGTCGCCTCGCAGCCGTA | 64.48 | 453 | Universal reverse | UNREV1025 | GGTTGTCCTCCAATTCATGTTA | 58.95 | — |
|
|