Research Article
A Novel Multiplex LAMP Assay for the Rapid and Accurate Diagnosis of Visceral Leishmaniasis Caused by Leishmania infantum from Iran
Table 3
Nested external and internal primers.
| Gene | TM | Primer | Sequence | Product size (bp) |
| ITS1, ITS2, 28S (external) | 57.3 | Forward | AGGCGTGTGTTTGTGTTGTG | 439 bp | 58.24 | Reverse | AGAGTGAGGGCGCGGATA |
| ITS1, ITS2, 28S (internal) | 59.35 | Forward | AACTCCTCTCTGGTGCTTGC | 189 bp | 55.25 | Reverse | AAAATGGCCAACGCGAAGTT |
|
|