Research Article
miR-185 and SEPT5 Genes May Contribute to Parkinson’s Disease Pathophysiology
Table 1
The primer pairs used for the gene amplifications.
| | Primers | Sequence () | GC% | (°C) | PCR product length () |
| | SEPT5 (forward) | GCTGAGGAACGCATCAAC | 55.6% | 56.5°C | 167 | | SEPT5 (reverse) | AACTGCTGGTCTACATAGTC | 45.0% | 55.2°C | | LRRK2 (forward) | CCTGGATTGCTGGAGATTG | 52.6% | 57.3°C | 175 | | LRRK2 (reverse) | GAATGGTGAGCCTTGGTTG | 52.6% | 56.5°C | | PARK2 (forward) | GACGCTCAACTTGGCTACTC | 55.0% | 57.1°C | 131 | | PARK2 (reverse) | CACTCCTCGGCACCATAC | 61.0% | 57.6°C | | β-act (forward) | CGTGCGTGACATTAAAGAGAAG | 45.5% | 58.5°C | 134 | | β-act (reverse) | CATTGCCGATAGTGATGACC | 50.0% | 57.6°C | | miR-185 (forward) | Exclusively designed by Bon Yakhteh Company, Tehran, Iran | — | — | — | | miR-185 (reverse) | Exclusively designed by Bon Yakhteh Company, Tehran, Iran | — | — | | U67 (forward) | Exclusively designed by Bon Yakhteh Company, Tehran, Iran | — | — | — | | U67 (reverse) | Exclusively designed by Bon Yakhteh Company, Tehran, Iran | — | — |
|
|
