Toxicity of DON on GPx1-Overexpressed or Knockdown Porcine Splenic Lymphocytes In Vitro and Protective Effects of Sodium Selenite

Ren, Zhihua; Chen, Changhao; Fan, Yu; Chen, Chaoxi; He, Hongyi; Wang, Xuemei; Zhang, Zhuo; Zuo, Zhicai; Peng, Guangneng; Hu, Yanchun; Xu, Zhiwen; Tao, Siyi; Mao, Xinru; Deng, Junliang

doi:https://doi.org/10.1155/2019/5769752

Oxidative Medicine and Cellular Longevity

On this page

Abstract Introduction Materials and Methods Results Discussion Data Availability Additional Points Conflicts of Interest Authors’ Contributions Acknowledgments References Copyright Related Articles

Research Article | Open Access

Volume 2019 | Article ID 5769752 | https://doi.org/10.1155/2019/5769752

Toxicity of DON on GPx1-Overexpressed or Knockdown Porcine Splenic Lymphocytes In Vitro and Protective Effects of Sodium Selenite

Zhihua Ren,¹Changhao Chen,¹Yu Fan,¹Chaoxi Chen,²Hongyi He,¹Xuemei Wang,¹Zhuo Zhang,¹Zhicai Zuo,¹Guangneng Peng,¹Yanchun Hu,¹Zhiwen Xu,¹and Siyi Tao¹ et al.

Academic Editor: Ada Popolo

Received20 Sept 2018

Revised01 Dec 2018

Accepted12 Dec 2018

Published28 Feb 2019

Abstract

Deoxynivalenol (DON) is a common contaminant of grain worldwide and is often detected in the human diet and animal feed. Selenium is an essential trace element in animals. It has many biological functions. The role of selenium in the body is mainly orchestrated by selenoprotein. Glutathione peroxidase (GPx) also exists widely in the body and has attracted much attention due to its high antioxidant capacity. In order to explore the effect of the GPx1 gene on toxicity of DON, in this study, we overexpressed or knockdown GPx1 in porcine splenic lymphocytes, then added different concentrations of DON (0.1025, 0.205, 0.41, and 0.82 μg/mL) and sodium selenite (2 μmol/L) to the culture system. Using various techniques, we detected antioxidant function, free radical content, cell apoptosis, and methylation-related gene expression to explore the effect of GPx1 expression on DON-induced cell damage. We also explored whether selenium can antagonize the toxicity of DON in these two cell models and revealed the protective effect of sodium selenite on DON-induced cell damage in GPx1-overexpressing or knockdown splenic lymphocytes. Finally, our findings revealed the following: (1) GPx1 can regulate the antioxidant capacity, apoptosis rate, and expression of DNA methylation-related genes in pig splenic lymphocytes. (2) Na₂SeO₃ (2 μmol/L) can regulate the antioxidant capacity, apoptosis rate, and expression of DNA methylation-related genes in pig splenic lymphocytes, and this effect is more significant in GPx1-overexpressing cells than in GPx1-knockdown cells. (3) DON can cause oxidative damage, apoptosis, and methylation injury in GPx1-overexpressing or knockdown pig splenic lymphocytes in a concentration-dependent manner. (4) Na₂SeO₃ (2 μmol/L) can antagonize the toxic effect of DON on GPx1-overexpressing or knockdown pig splenic lymphocytes. Our findings may have important implications for food/feed safety, human health, and environmental protection.

1. Introduction

Mycotoxin is a secondary metabolite of mold. It can exist in grain during various stages of harvesting and food processing and is generally stable and therefore not easily destroyed or removed. It can lead to a variety of toxic symptoms in humans and animals contaminated with mycotoxin [1]. Common fungi that contaminate cereals and other foods include Penicillium, Aspergillus, and Fusarium [2]. Fusarium toxins are the largest group of mycotoxins that affect the global food industry, the feed industry, and the aquaculture industry [3]. DON is a Trichoderma toxin, mainly produced by Fusarium graminearum. It is a common cause of food contamination. Different species of animals have different levels of tolerance to DON, with pigs being among the most sensitive [4]. DON can not only reduce the utilization rate of animal feed but also reduce the growth and reproductive performance of animals, as well as destroying their immune system.

Deoxynivalenol is also known as vomit toxin because it interacts with the 5-serotonin and dopamine receptors located in the vomit center of the brain stem. Consumption of food contaminated by DON therefore causes acute poisoning symptoms such as vomiting, diarrhea, and anorexia [5]. Studies have shown that DON can disrupt the transduction of cell information, cell differentiation, cell growth, and synthesis of macromolecular substances [4]. DON can act on the immune system of the body, resulting in immunosuppression and lowering the body’s immunity.

DON is a serious source of global pollution. The detection rate of DON in fresh harvested wheat in Brazil was 99%, and the exceeding standard rate was 10% [6]. The detection rate of DON in plant-derived foods in Czech and the United States is 78% [7].

During the process of peroxidation, lipids produce many free radicals and non-free radical products, resulting in cell dysfunction. Among them, the lipid free radicals of medium reactivity are easily diffused into the nucleus, where they react with a base and directly affect DNA and RNA, causing gene mutations and leading to cell carcinogenesis. A study found that the oxidative damage caused by Fusarium toxins is likely to be due to destruction of the body’s antioxidant system and acceleration of the production of free radicals [8], which has been confirmed in Caco-2 and HepG2 cells [9]. Ren and colleagues [10] used 0.15 mg/mL DON to poison Kunming mice several times and found that the concentration of superoxide dismutase (SOD) and glutathione (GSH) in the brains of affected mice was significantly lower than that in the normal group. DON can reduce the total antioxidant capacity of cells and the ability of cells to inhibit hydroxyl radicals. Thus, whether in vivo or in vitro, the toxicity of DON is closely related to the induction oxidative stress.

Previous studies have shown that DON can interfere with and damage ribosomes [11], inhibit the synthesis of protein and nucleic acids [12, 13], and promote apoptosis [14, 15]. Oxidative stress is an important mechanism of DON-mediated cytotoxicity and apoptosis [16]. The main mechanism by which DON induces oxidative stress is via the accumulation of a large amount of reactive oxygen species (ROS) in the cell, which disrupts the balance between oxidation and antioxidant activity in the cells. ROS accumulation causes lipid peroxidation on the lipid membrane and damage to the phospholipids and lipoprotein on the membrane, in turn damaging the DNA by a transmission chain reaction [17]. Oxidative stress in cells can result in oxidative damage and promotes cell apoptosis [15].

A high dose of DON can cause immune suppression, resulting from the DON-induced apoptosis of immune cells and inhibition of protein translation. A high dose of DON can damage the immune system and induce the apoptosis of leukocyte, macrophages, T cells, and B cells. In pigs, DON can not only compromise animal immunity but also lead to the repeated outbreak of diseases [18].

The spleen, as the target organ of DON, plays an important role in DON-mediated effects. DON can change the morphological structure of the spleen and affect the function of spleen. When the spleen structure changes and is damaged, immune function is also affected. When DON acts on spleen lymphocytes, it can cause oxidative damage to cells, affect the expression of immunoglobulins, and change the antioxidant index. Ren and colleagues [10] administered mice with DON at 2.5 mg/kg body weight on days 3, 5, 8, and 12. In a study of the changes in the antioxidant index of spleen lymphocytes induced by DON, Ren and colleagues [18] used DON at different doses (0.006, 0.3, 1.5, and 7.5 μg/mL) to direct the pig spleen lymphocytes and found that the SOD, catalase (CAT), glutathione peroxidase (GPx), and GSH content decreased significantly compared with the control group, whereas the malondialdehyde (MDA) content increased significantly.

Selenium has many biological functions in organisms, the most important of which is its antioxidant effect. The biological function of selenium is mainly mediated by selenoprotein, which exists in the form of selenocysteine. GPx is an important peroxide decomposition enzyme that is widely distributed in the body. Selenium is a component of GPx and can enhance its vitality. GPx has strong antioxidant capacity. GPx can catalyze reduced GSH into oxidized glutathione (GSSG), reduce toxic peroxide (ROOH) into harmless hydroxyl compounds, and decompose hydrogen peroxide (H₂O₂), so as to protect the structure and function of the cell membrane from peroxide interference and damage. Studies have shown that there are four types of GPx, one of which is the cell type glutathione peroxidase widely found in various cells, also known as GPx1.

Studies have shown that selenium has the effect of antagonizing DON toxicity. Placha and coworkers [19] added 3 mg/kg DON toxin to a broiler diet and added excessive organic selenium (1 mg/kg) to the selenium test group to observe the antagonistic effect of selenium on DON. The results showed that a subtoxic dose of DON did not cause any clinical symptoms, but the activity of SOD was reduced, the MDA content was increased, and GPx activity was increased. The selenium test group significantly decreased the toxicity of DON, increased the activity of SOD, reduced the content of MDA, and significantly increased the activity of GPx in the tissues, and the organic selenium regulated the abnormal activity of GPx in the chicken duodenum caused by DON.

To sum up, we intend to overexpress or knock down the GPx1 gene of porcine spleen lymphocytes cultured in vitro and then use different concentrations of DON to expose it. Then, we observe whether there is any change in the antagonism of selenium to DON when GPx1 is too much or too little.

2. Materials and Methods

2.1. Cell Treatments and Grouping

The pig spleen was collected from 6-month-old Duchang commercial pigs from the Daxing pig slaughterhouse in Ya’an, Sichuan, China.

The pig spleen was aseptically extracted and after a few minutes was soaked in 75% alcohol. It was then washed three times in precooled PBS, and the connective tissue around the spleen was removed. After another two washes in precooled PBS, the remaining spleen was cut and transferred to a stainless steel screen (stainless steel screen (200) fixed on a petri dish containing 10 mL of PBS). Then, using the inner core of a disposable syringe, the spleen was gently squeezed into the PBS solution and the splenic lymphocyte suspension was adjusted with PBS solution to the desired concentration. Then, the cell suspension was slowly added into the glass centrifuge tube, which was prefitted with the splenic lymphocyte separation solution, and the cell suspension was slowly moved into the upper layer of the separated splenic lymphocytes at a 1 : 1 volume ratio. After centrifugation at 400 × for 20 min, the supernatant was discarded and the middle layer of lymphocytes was transferred to another glass centrifuge tube. Five volumes of precooled PBS solution were added, the mixture was centrifuged at 250 × for 10 min, and the cells were washed two more times in PBS then once in RPMI-1640 complete culture media (containing 10% fetal bovine serum). The cells were finally suspended in RPMI-1640 complete culture media, plated, trypan blue-stained, and counted. The cell concentration was , and the cell survival rate was over 95%. The cells could therefore be used for subsequent experiments.

According to the results of previous laboratory tests [20], the concentration of DON was determined to be 1/8 IC50, 1/4 IC50, 1/2 IC50, and IC50 (0.1025, 0.205, 0.41, and 0.82 μg/mL), and Na₂SeO₃ concentration was the best concentration of 2 μmol/L. The cells were grouped as shown in Table 1. DON was purchased from Sigma-Aldrich (CAS Number 51481-10-8, #D0156), and Na₂SeO₃ was purchased from Sigma-Aldrich (CAS Number 10102-18-8, #S9133).

2.2. Establishment of GPx1-Overexpressing Pig Splenic Lymphocytes In Vitro

2.2.1. Construction and Verification of the Recombinant Plasmid pEGFP-N1-GPx1

(1) Amplification of GPx1. The electrophoretic results showed that the total RNA extracted from the splenic lymphocytes was reverse-transcribed into cDNA and used as a template for the PCR amplification of the GPx1 gene. Agarose gel electrophoresis (1%) of the PCR products showed that the length of the single target gene was 621 bp, as shown in Figure 1. The sequence of the GPx1 primers used for the amplification was as follows: F: CTCGAGATGTGCGCCGCTCAGCGTTCCGCTG and R: CCGCGGGGCACTGCTAGGCTCCTGGGACA.

(a)

(b)

(c)

(d)

(e)

(f)

Figure 1

Establishment of GPx1 gene-overexpressing model of pig splenic lymphocytes. (a) shows the result of PCR amplification of the GPx1 gene of porcine splenic lymphocytes; it shows the PCR products, showing that the length of the single target gene was 621 bp. The PCR-amplified GPx1 gene was inserted into PEGFP-N1, a eukaryotic vector with kanamycin resistance, to obtain the recombinant plasmid pEGFP-N1-GPx1. Positive colonies were screened on kanamycin-containing plates. To avoid false positives, the selected colonies were screened by PCR, as shown in (b). The positive colonies were then verified by XhoI and SacII double-enzyme digestion to obtain bands of 630 bp and 4700 bp, as shown in (c). The X-tremeGENE HP DNA transfection reagent was used to transfect the purified plasmid into pig spleen lymphocytes over 48 h, and the efficiency of transfection was detected by fluorescence inverted microscopy, as shown in (d and e). (f) is the result of protein immunoblotting for GPx1. In (f), 1 is the untreated control group, 2 is the pEGFP-N1-transfected empty vector group, and 3 is the pEGFP-N1-GPx1-transfected overexpressed group.

(2) Construction and Verification of Recombinant Plasmid pEGFP-N1-GPx1. The PCR-amplified GPx1 gene was inserted into PEGFP-N1, a eukaryotic vector with kanamycin resistance, to obtain the recombinant plasmid pEGFP-N1-GPx1. Positive colonies were screened on kanamycin-containing plates. To avoid false positives, the selected colonies were screened by PCR, as shown in Figure 1. The positive colonies were then verified by XhoI and SacII double-enzyme digestion to obtain bands of 630 bp and 4700 bp, as shown in Figure 1.

(3) Sequencing of the pEGFP-N1-GPx1 Recombinant Plasmid. The pEGFP-N1 plasmid is 4.7 kb in size, and the target gene GPx1 is 621 bp in size. The sequencing results confirmed the correct construction of the recombinant plasmid pEGFP-N1-GPx1.

2.2.2. Establishment of the Transfection Model Using Recombinant Plasmid pEGFP-N1-GPx1 in Pig Spleen Lymphocytes

The X-tremeGENE HP DNA Transfection Reagent was used to transfect the purified plasmid into pig spleen lymphocytes over 48 h, and the efficiency of transfection was detected by fluorescence inverted microscopy, as shown in Figure 1.

2.3. Establishment of GPx1 Knockdown Pig Spleen Lymphocytes In Vitro

2.3.1. Design of GPx1-siRNA

Based on the published pig GPx1 mRNA (GenBank accession number NM-214201.0), siRNAs were designed using the BLOCK-iT™ siRNAs software (Thermo Fisher Scientific). The positive siRNA sequence 5-GGGACUACACCCAGAUGAATT-3 and the negative siRNA sequence 5-UUCGUAUCUGGGUGUACCCTT-3 were synthesized by Thermo Fisher Scientific. A FAM fluorescence tag was added to the siRNA as needed.

2.3.2. Establishment of a Transfection Model for GPx-1 Knockdown Pig Splenic Lymphocytes

Transfection was carried out with 10 μL of RFect^PM primary cell nucleotide transfection reagent and GPx1-siRNA, and the transfection efficiency was detected by flow cytometry after 24 h of transfection.

2.4. Determination of Antioxidant Capacity

After transfection, cells were cultured for 48 h and then centrifuged to collect the supernatant or precipitate. ELISA kits (ELISA kit is purchased from Nanjing Jiancheng Bioengineering Institute, China) were employed to determine the antioxidant-related indexes in the cell supernatant or precipitant, including glutathione peroxidase (GSH-Px), GSH, SOD, total antioxidant capacity (T-AOC), CAT, MDA, H₂O₂, and ROS (flow cytometry was used to detect the fluorescence intensity of ROS). The absorbance at 405, 450, and 532 nm was measured using a spectrophotometer. RT-PCR was used to determine the mRNA expression of GPx1 and SOD. Each experiment set three repetitions.

2.5. Determination of Apoptosis

After transfection, cells were cultured for 48 h and were then harvested by centrifugation and stained with Annexin V FITC/PI (Nanjing Jiancheng Bioengineering Institute). The cell apoptosis rate was measured by flow cytometry (Accuri C6, BD Biosciences), and the mRNA expression level of Bcl-2 and Bax was detected by RT-PCR. Each experiment set three repetitions.

2.6. Detection of Genes Related to Methylation

RT-PCR was used to detect the mRNA expression of methylation-related genes, including methyltransferase DNMT1, DNMT3a, and DNMT3b and the demethylation gene MBD2. Each experiment set three repetitions.

2.7. Statistical Analysis

Using SPSS 22.0 software, Student’s test was used to compare statistics. Results are presented as .

3. Results

3.1. Establishment of the Transfection Model Using Recombinant Plasmid pEGFP-N1-GPx1 in Porcine Spleen Lymphocytes

The transfection efficiency of recombinant plasmid pEGFP-N1-GPx1 in porcine spleen lymphocytes was 62.41%, and expression of the GPx1 gene was detected by real-time fluorescent quantitative PCR, the results of which are presented in Table 2. The expression of GPx1 mRNA in the overexpressing group was 3.876 times higher than that in the control group. The results of protein immunoblotting for GPx1 are shown in Figure 1. The results are expressed by mean deviation, and the mean variance analysis was used to compare the differences among groups as shown in Table 3. The results showed that there was no significant difference between the control group and the empty vector group. The expression level of GPx1 protein in the overexpression group was 1.570 times higher than that in the control group, confirming that it could be used in subsequent experiments.

3.2. Establishment of a Transfection Model for GPx-1 Knockdown Porcine Splenic Lymphocytes

The transfection efficiency of GPx1-siRNA in the spleen lymphocytes of pigs was 91.8%, as shown in Figure 2. The expression of GPx1 mRNA was detected by real-time fluorescence quantitative PCR as shown in Table 4, and the expression of GPx1 mRNA in the silent group was 0.284 times that of the control group, confirming its suitability for use in subsequent experiments.

3.3. Related Index of the GPx1 Overexpression Group

3.3.1. Effect of Na₂SeO₃ on DON-Induced Oxidative Toxicity of GPx1-Overexpressed Splenic Lymphocytes of Pigs

ELISA kit was used to detect the levels of GSH-Px, GSH, SOD, T-AOC, and CAT among the experimental groups shown in Table 1, to detect the MDA content and the presence of free radicals. The results are presented in Tables 5(a)–5(k). The GPx1-overexpressed type pig spleen lymphocyte cultured for 48 h, compared with the negative control group, the intracellular antioxidant index, the inhibition of hydroxyl free radical, and the mRNA expression of GPx1 and SOD were improved, and the levels of GSH-Px, T-AOC, and CAT increased significantly (). The contents of MDA, H₂O₂, and ROS decreased, and H₂O₂ decreased significantly ().

After adding Na₂SeO₃ alone, the antioxidant index and the expression of mRNA in the two genes were improved compared with the control (C) group. With the exception of SOD and T-AOC, the other indexes were significantly increased ( or ). However, the contents of MDA, H₂O₂, and ROS showed a decreasing trend, and the content of free radicals decreased significantly ().

After adding DON alone, compared with the C group, the content of antioxidant index, the inhibition of hydroxyl free radical, and the expression of mRNA in the two genes were reduced, and the degree of decline increased with the increase in DON concentration, most of which were significantly decreased ( or ). The contents of MDA, H₂O₂, and ROS all increased and showed an upward trend with the increase in the DON concentration, mostly showing a significant increase ( or ).

After the combination of DON and Na₂SeO₃, the antioxidant capacity, the inhibition of hydroxyl radical ability, and the mRNA expression of two genes were improved, and most of them were significantly increased in the SD1 or SD2 group (). MDA, H₂O₂, and ROS all showed a downward trend, while MDA showed a significant decrease ().

3.3.2. Effect of Na₂SeO₃ on DON-Induced Apoptosis of GPx1-Overexpressing Splenic Lymphocytes from Pigs

Cells from the experimental group shown in Table 1 were cultured for 48 h and were then harvested and stained by Annexin V FITC/PI double staining. Flow cytometry was then used to detect the apoptosis rate, and the mRNA expression of Bcl-2 and Bax was detected by RT-PCR. Apoptotic cells are shown in Figure 3. In the images, the first and fourth quadrants show early apoptotic cells and late apoptotic cells, respectively, and the third quadrant shows normal cells. The survival rate of normal cells in group C was higher than that of the negative control and empty vector group. In groups D1–D4, the apoptosis rate increased with the increase in the DON concentration. After adding Na₂SeO₃, the apoptosis rate in the SD group was reduced. This suggested that Na₂SeO₃ can antagonize the DON-induced apoptosis of GPx1-overexpressing splenic lymphocytes in pigs.

(a)

(b)

(c)

(d)

(e)

(f)

(g)

The mRNA expression of apoptosis-related genes Bcl-2 and Bax is shown in Tables 6(a) and 6(b). The expression of Bcl-2 mRNA in the GPx1 overexpression group was higher than that of the negative control and empty vector groups. The mRNA expression of Bax was lower than that of the negative control and empty vector groups.

After the addition of 2 μmol/L Na₂SeO₃, the expression of Bcl-2 and Bax was significantly increased or decreased () compared with the control group.

After the addition of DON alone, the expression of Bcl-2 and Bax decreased or increased, respectively, compared with the control group, and in the other groups two genes were significantly reduced or elevated (), with the exception of Bcl-2 in the D1 group.

The addition of both DON and Na₂SeO₃ resulted in a further decrease in Bcl-2 expression and increase in Bax expression, and the expression in SD1 or SD2 was significant ().

3.3.3. Effect of Na₂SeO₃ and DON on the Expression of Methylation-Related Genes in GPx1-Overexpressing Pig Splenic Lymphocytes

The mRNA expression of methyltransferase-related genes, including the methyltransferases DNMT1, DNMT3a, and DNMT3b and the demethylation enzyme MBD2, was detected by RT-PCR after 48 h of cultured of cells from the experimental groups detailed in Table 1. The results are shown in Tables 7(a)–7(d). The mRNA expression of the methyltransferases (DNMT1, DNMT3a, and DNMT3b) was higher in the control group than in the negative control or empty vector groups, whereas the expression of the demethylation enzyme (MBD2) was low.

After the addition of 2 μmol/L Na₂SeO₃, the expression of the methyltransferase increased significantly (), whereas the expression of the demethylation enzyme decreased significantly ().

With the addition of DON, the expression of the methyltransferases was reduced compared with the control group, and the more the DON concentration increased, the lower the expression of methyltransferases, and DNMT1 decreased significantly (). Whereas the expression of the methylation enzymes increased in GPx1-overexpressing splenic lymphocytes following the addition of DON, and the more the DON concentration increased, the higher the expression of demethylation enzymes, with significant increases in the D3 and D4 groups ().

After the combined addition of DON and Na₂SeO₃, the expression of methyltransferase increased and the expression of demethylation enzyme decreased in comparison with the DON alone group.

3.4. Related Index of the GPx1 Knockdown Group

3.4.1. Effect of Na₂SeO₃ on DON-Induced Oxidative Toxicity of the GPx1 Knockdown Splenic Lymphocytes of Pigs

ELISA kits were used to detect GSH-Px, GSH, SOD, T-AOC, CAT, and other antioxidant indexes and to detect the MDA content and free radical content in cells of the experimental groups detailed in Table 1. The results are shown in Tables 8(a)–8(k). After 48 h of culturing of the GPx1 knockdown pig splenic lymphocytes, the intracellular antioxidant index and the mRNA expression of GPx1 and SOD were reduced, most of them significantly () compared with the negative control group. However, MDA, H₂O₂, and ROS levels increased significantly ( or ).

After the addition of 2 μmol/L Na₂SeO₃, the intracellular antioxidant index and the mRNA expression of GPx1 and SOD were increased, most significantly () compared with the M group, while MDA, H₂O₂, and ROS expression was decreased, and the levels of ROS were significantly decreased ().

After the addition of DON alone, the intracellular antioxidant index, the inhibition of hydroxyl radicals and the mRNA expression of GPx1 and SOD decreased compared with the M group, and the higher the concentration of DON, the more significant the decrease ( or ), and in the D1 group, GSH and GSH-Px were also decreased. By contrast, MDA, H₂O₂, and ROS levels increased, and the higher the DON concentration, the more significant the increase ( or ). After the addition of both DON and Na₂SeO₃, the intracellular antioxidant index, the ability to inhibit hydroxyl radicals, and the mRNA expression of GPx1 and SOD were increased, and the SD1 and SD2 groups were significantly increased () compared with the DON alone groups.

3.4.2. Effect of Na₂SeO₃ on DON-Induced Apoptosis of GPx1 Knockdown Splenic Lymphocytes of Pigs

Cells from the experimental groups detailed in Table 1 were cultured for 48 h, then harvested and stained with Annexin V FITC/PI double staining. Flow cytometry was employed to detect the apoptosis rate, and the mRNA expression of Bcl-2 and Bax was detected by RT-PCR. Cell apoptosis is shown in Figure 4. In the images, the first and fourth quadrants show early apoptotic cells and late apoptotic cells, respectively, and the third quadrant shows normal cells. The results revealed that the survival rates of normal cells in group M were lower than those in group P. After the addition of DON, the apoptosis rate increased with the increase in the DON concentration. After the addition of Na₂SeO₃, the apoptosis rate in the SD groups was improved.

(a)

(b)

(c)

(d)

(e)

(f)

The mRNA expression of the apoptosis-related genes Bcl-2 and Bax in each of the groups is shown in Tables 9(a) and 9(b). The expression of Bcl-2 mRNA in group M was lower than that in group P, and the mRNA expression of Bax was higher than that in group P.

After the addition of 2 μmol/L Na₂SeO₃, the expression of Bcl-2 and Bax increased or decreased, respectively, compared with the M group.

After the addition of DON, the expression of Bcl-2 and Bax decreased or increased, respectively, compared with the M group. By increasing the DON concentration, the decreased or increased expression of the two genes was more significant, indicating that DON could lead to the apoptosis of GPx1 knockdown pig splenic lymphocytes, and this effect was concentration-dependent.

After the addition of both DON and Na₂SeO₃, the decrease in Bcl-2 expression and the increase in Bax expression showed that Na₂SeO₃ could antagonize the apoptosis induced by DON in GPx1 knockdown spleen lymphocytes of pigs.

3.4.3. Effect of Na₂SeO₃ on the Expression of Methylation-Related Genes Induces by DON in GPx1-Knockdown Pig Splenic Lymphocytes

Cells of the experimental groups detailed in Table 1 were cultured for 48 h, then the mRNA expression of methylation-related genes, including the methyltransferases DNMT1, DNMT3a, and DNMT3b and the demethylation enzyme MBD2, was detected by RT-PCR. The results are shown in Tables 10(a)–10(d). The expression of mRNA in group M (DNMT1, DNMT3a, and DNMT3b) is lower than that in the P group, and the expression of MBD2 was higher.

After the addition of 2 μmol/L Na₂SeO₃, the expression of methyltransferases increased and the expression of the demethylation enzyme decreased.

Following the addition of DON alone, the expression of methyltransferases decreased compared with the M group, and this decrease was more significant as the DON concentration was increased, whereas the expression of the demethylation enzyme increased, and this increase was more significant as the DON concentration increased. In addition to the D1 and D2 groups, the other groups also showed a significant increase in methyltransferase expression ().

After the addition of both DON and Na₂SeO₃, the expression of methyltransferases increased and the expression of the demethylation enzyme decreased in comparison with the DON alone group.

4. Discussion

In this study, the GPx1 gene was overexpressed or knockdown in the splenic lymphocytes of pigs and the cells were then cultured with different concentrations of DON and/or 2 μmol/L Na₂SeO₃. Then, the antioxidative function, the free radical content, the apoptosis rate, and the expression of methylation-related genes were determined. These experiments explored the effects of the GPx1 gene on the cytotoxicity induced by DON at the molecular level and revealed the protective effects of Na₂SeO₃ on cell injury induced by DON in GPx1-overexpressed or knockdown porcine splenic lymphocytes.

Selenium, an essential trace element, has many biological functions, such as improving the body’s antioxidant capacity, regulating the immunity of the body, affecting the body’s reproductive function, antagonizing the toxicity of toxic substances, and promoting growth. Selenoprotein plays a key role in mediating these effects [21]. Overexpression of GPx1 can protect cells from the damage caused by H₂O₂ and fatty peroxide and can also prevent apoptosis induced by H₂O₂. GPx1 has the potential to protect many tissues from oxidative damage. In this study, the overexpression of GPx1 enhanced the antioxidant capacity of splenic lymphocytes and reduced the apoptosis rate of the cells, whereas the antioxidant capacity of the cells was weakened after GPx1 knockdown, and the apoptosis rate of the cells increased. These two cell models provided evidence for the protective effect of GPx1 on pig splenic lymphocytes. Different concentrations of Na₂SeO₃ could upregulate the expression and activity of GPx mRNA [22]. The experimental results showed that the expression of mRNA in GPx1 was higher than that of normal pig splenic lymphocytes, suggesting that selenium (added in the form of 2 μmol/L Na₂SeO₃) had a significant effect on GPx1 in splenic lymphocytes. GPx as an important peroxidase in the body, and selenium, in the form of selenoprotein, affects its function.

DON has been reported to upregulate the immune system at low concentration [15], whereas at high concentration it has been shown to have an immunosuppressive effect. This difference may be caused by the concentration and duration of DON exposure and the difference in sensitivity between animals. In this study, four concentrations of DON were added to GPx1-overexpressing or knockdown pig splenic lymphocytes in vitro, and different extents of oxidative damage were observed. Under the two high concentrations of D3 and D4, a significant reduction in the antioxidant indices was predominantly observed (), whereas this reduction was predominantly not significant () under the two lower concentrations of D1 and D2. This likely indicates that pigs are sensitive to DON at higher concentrations.

Regarding cell apoptosis, DON can activate apoptosis-related genes, promoting the expression of Bax and Bid and inducing murine thymocytes and human colon cancer cells (HT29) to induce apoptosis [19, 23]. It has previously been reported that the addition of different concentrations of DON to porcine hepatocytes induced cell apoptosis after 6 h, and the higher the concentration of DON, the higher the rate of apoptosis [24]. Similarly, in our study, four different concentrations of DON induced apoptosis of GPx1-overexpressing or knockdown pig splenic lymphocytes, and the higher the concentration, the higher the rate of apoptosis, along with decreased mRNA expression of Bcl-2 and increased mRNA expression of Bax. However, the apoptosis rate in GPx1-overexpressing cells in groups D1–D4 was lower than that of GPx1-knockdown cells in these groups. Furthermore, the expression of Bcl-2 and Bax mRNA showed that overexpression of GPx1 could effectively alleviate the apoptosis induced by DON.

Regarding DNA methylation, DNMT3a, DNMT3b, and DNMT1 synergistically maintain the stability of DNA methylation [25], whereas MBD2 mediates demethylation. It has been reported that the aberrant gene expression may be related to DNA demethylation [26]. Most of the changes in DNA methylation are due to chemicals in food and in the environment. For example, the heavy metal arsenic can induce DNA injury in the liver of mice, and the level of genomic methylation is reduced [27] in a dose- and time-dependent manner [28]. Similarly, exposure of rat liver cells to cadmium led to decreased expression of DNMT and a decrease in total methylation [29]. Aberrant DNA methylation is also associated with tumorigenesis, because tumors are often associated with DNA mutations that lead to a decrease in total methylation or an increase in the methylation level of the CpG island in the promoter region. In rat hepatocytes, protooncogenes were found to have a low methylation status, which promoted the expression of oncogenes and the amplification of cancer cells [29]. In the current study, knockdown of GPx1 resulted in decreased expression of the DNMT genes and increased expression of MBD2, whereas GPx1 overexpression resulted in increased expression of DNMT and decreased expression of MBD2. This indicated that GPx1 can regulate the expression of methylation-related genes. Following exposure to 2 μmol/L Na₂SeO₃, DNMT expression increased and MBD2 expression decreased, indicating that selenium could also regulate methylation-related genes. DON was shown to downregulate DNMT expression and upregulate MBD2 expression, and the higher the concentration of DON, the greater the effect. This may also implicate DON in the process of tumorigenesis. Selenium was shown to antagonize the effect of DON on DNA methylation.

In conclusion, overexpression of the GPx1 gene can reduce oxidative damage in porcine splenic lymphocytes, reduce the rate of apoptosis, and reduce the degree of DNA methylation. Following knockdown of the GPx1 gene, the opposite trends were observed including increased oxidative damage, increased apoptosis, and increased DNA methylation damage. However, independent of overexpression or knockdown, exposure of splenic lymphocytes to DON caused concentration-dependent oxidative stress, apoptosis, and DNA methylation. Treatment with 2 μmol/L Na₂SeO₃ enhanced mRNA expression of the GPx1 gene and antagonized the toxicity of DON, thereby improving the intracellular environment.

Our findings revealed the following: (1) GPx1 can regulate the antioxidant capacity, apoptosis rate, and expression of DNA methylation-related genes in pig splenic lymphocytes. (2) Na₂SeO₃ (2 μmol/L) can regulate the antioxidant capacity, apoptosis rate, and expression of DNA methylation-related genes in pig splenic lymphocytes, and this effect is more significant in GPx1-overexpressing cells than in GPx1-knockdown cells. (3) DON can cause oxidative damage, apoptosis, and methylation injury in GPx1-overexpressing or knockdown pig splenic lymphocytes in a concentration-dependent manner. (4) Na₂SeO₃ (2 μmol/L) can antagonize the toxic effect of DON on GPx1-overexpressing or knockdown pig splenic lymphocytes.

Data Availability

All data used to support the findings of this study are included within the article.

Additional Points

Highlights. Primary culture of porcine splenic lymphocytes in vitro. Overexpress or knockdown of GPx1 gene to explore its role in cytotoxicity of DON

Conflicts of Interest

The authors declare that they have no competing interests.

Authors’ Contributions

Zhihua Ren, Changhao Chen, Yu Fan, and Chaoxi Chen contributed equally to this work and should be considered co-first authors.

Acknowledgments

This work was supported by the National Natural Science Fund (Project No. 31402269). We thank Kate Fox, DPhil, from Liwen Bianji, Edanz Group China (http://www.liwenbianji.cn/ac), for editing the English text of a draft of this manuscript.

References

F. Chen, Y. Ma, C. Xue et al., “The combination of deoxynivalenol and zearalenone at permitted feed concentrations causes serious physiological effects in young pigs,” Journal of Veterinary Science, vol. 9, no. 1, pp. 39–44, 2008.
View at: Publisher Site | Google Scholar
A. Bianchini and L. B. Bullerman, “MYCOTOXINS | classification,” Encyclopedia of Food Microbiology, vol. 2, pp. 854–861, 2014.
View at: Google Scholar
Z. H. Ren, R. Zhou, J. L. Deng et al., “Effects of the Fusarium toxin zearalenone (ZEA) and/or deoxynivalenol (DON) on the serum IgA, IgG and IgM levels in mice,” Food and Agricultural Immunology, vol. 25, no. 4, pp. 600–606, 2014.
View at: Publisher Site | Google Scholar
J. J. Pestka and A. T. Smolinski, “Deoxynivalenol: toxicology and potential effects on humans,” Journal of Toxicology and Environmental Health, Part B: Critical Reviews, vol. 8, no. 1, pp. 39–69, 2005.
View at: Publisher Site | Google Scholar
D. P. Morgavi and R. T. Riley, “Fusarium and their toxins: mycology, occurrence, toxicity, control and economic impact,” Animal Feed Science and Technology, vol. 137, no. 3-4, pp. 199-200, 2007.
View at: Publisher Site | Google Scholar
S. M. Tralamazza, R. H. Bemvenuti, P. Zorzete, F. de Souza Garcia, and B. Corrêa, “Fungal diversity and natural occurrence of deoxynivalenol and zearalenone in freshly harvested wheat grains from Brazil,” Food Chemistry, vol. 196, pp. 445–450, 2016.
View at: Publisher Site | Google Scholar
Z. Veprikova, M. Zachariasova, Z. Dzuman et al., “Mycotoxins in plant-based dietary supplements: hidden health risk for consumers,” Journal of Agricultural and Food Chemistry, vol. 63, no. 29, pp. 6633–6643, 2015.
View at: Publisher Site | Google Scholar
P. Sobrova, V. Adam, A. Vasatkova, M. Beklova, L. Zeman, and R. Kizek, “Deoxynivalenol and its toxicity,” Interdisciplinary Toxicology, vol. 3, no. 3, pp. 94–99, 2010.
View at: Publisher Site | Google Scholar
M. J. Shepherd and J. Gilbert, “Long-term storage stability of deoxynivalenol standard reference solutions,” Journal of Agricultural and Food Chemistry, vol. 36, no. 2, pp. 305–308, 1988.
View at: Publisher Site | Google Scholar
Z. H. Ren, H. D. Deng, Y. T. Deng et al., “Effect of the Fusarium toxins, zearalenone and deoxynivalenol, on the mouse brain,” Environmental Toxicology and Pharmacology, vol. 46, pp. 62–70, 2016.
View at: Publisher Site | Google Scholar
B. A. Rotter, “Invited review: toxicology of deoxynivalenol (vomitoxin),” Journal of Toxicology and Environmental Health, vol. 48, no. 1, pp. 1–34, 1996.
View at: Publisher Site | Google Scholar
V. I. Shifrin and P. Anderson, “Trichothecene mycotoxins trigger a ribotoxic stress response that activates c-Jun N-terminal kinase and p38 mitogen-activated protein kinase and induces apoptosis,” Journal of Biological Chemistry, vol. 274, no. 20, pp. 13985–13992, 1999.
View at: Publisher Site | Google Scholar
Y. Ueno, M. Nakajima, K. Sakai, K. Ishii, and N. Sato, “Comparative toxicology of trichothec mycotoxins: inhibition of protein synthesis in animal cells,” Journal of Biochemistry, vol. 74, no. 2, pp. 285–296, 1973.
View at: Google Scholar
Z. Islam, J. S. Gray, and J. J. Pestka, “p38 mitogen-activated protein kinase mediates IL-8 induction by the ribotoxin deoxynivalenol in human monocytes,” Toxicology and Applied Pharmacology, vol. 213, no. 3, pp. 235–244, 2006.
View at: Publisher Site | Google Scholar
J. J. Pestka, “Mechanisms of deoxynivalenol-induced gene expression and apoptosis,” Food Additives and Contaminants, vol. 25, no. 9, pp. 1128–1140, 2008.
View at: Publisher Site | Google Scholar
S. Mishra, P. D. Dwivedi, H. P. Pandey, and M. Das, “Role of oxidative stress in deoxynivalenol induced toxicity,” Food and Chemical Toxicology, vol. 72, no. 3, pp. 20–29, 2014.
View at: Publisher Site | Google Scholar
A. Braca, C. Sortino, M. Politi, I. Morelli, and J. Mendez, “Antioxidant activity of flavonoids from Licania licaniaeflora,” Journal of Ethnopharmacology, vol. 79, no. 3, pp. 379–381, 2002.
View at: Publisher Site | Google Scholar
Z. Ren, H. Deng, Y. Deng et al., “Combined effects of deoxynivalenol and zearalenone on oxidative injury and apoptosis in porcine splenic lymphocytes in vitro,” Experimental and Toxicologic Pathology, vol. 69, no. 8, pp. 612–617, 2017.
View at: Publisher Site | Google Scholar
I. Placha, R. Borutova, L. Gresakova, V. Petrovic, S. Faix, and L. Leng, “Effects of excessive selenium supplementation to diet contaminated with deoxynivalenol on blood phagocytic activity and antioxidative status of broilers,” Journal of Animal Physiology and Animal Nutrition, vol. 93, no. 6, pp. 695–702, 2009.
View at: Publisher Site | Google Scholar
X. Wang, Z. Zuo, C. Zhao et al., “Protective role of selenium in the activities of antioxidant enzymes in piglet splenic lymphocytes exposed to deoxynivalenol,” Environmental Toxicology and Pharmacology, vol. 47, pp. 53–61, 2016.
View at: Publisher Site | Google Scholar
C. B. Allan, G. M. Lacourciere, and T. C. Stadtman, “Responsiveness of selenoproteins to dietary selenium,” Annual Review of Nutrition, vol. 19, no. 1, pp. 1–16, 1999.
View at: Publisher Site | Google Scholar
F. Ren, X. Chen, J. Hesketh, F. Gan, and K. Huang, “Selenium promotes T-cell response to TCR-stimulation and ConA, but not PHA in primary porcine splenocytes,” PLoS One, vol. 7, no. 4, article e35375, 2012.
View at: Publisher Site | Google Scholar
Y. Ma, A. Zhang, Z. Shi et al., “A mitochondria-mediated apoptotic pathway induced by deoxynivalenol in human colon cancer cells,” Toxicology In Vitro, vol. 26, no. 3, pp. 414–420, 2012.
View at: Publisher Site | Google Scholar
O. Mikami, S. Yamamoto, N. Yamanaka, and Y. Nakajima, “Porcine hepatocyte apoptosis and reduction of albumin secretion induced by deoxynivalenol,” Toxicology, vol. 204, no. 2-3, pp. 241–249, 2004.
View at: Publisher Site | Google Scholar
F. Chédin, “The DNMT3 family of mammalian de novo DNA methyltransferases,” Progress in Molecular Biology and Translational Science, vol. 101, pp. 255–285, 2011.
View at: Publisher Site | Google Scholar
H. Barr, A. Hermann, J. Berger et al., “Mbd2 contributes to DNA methylation-directed repression of the Xist gene,” Molecular and Cellular Biology, vol. 27, no. 10, pp. 3750–3757, 2007.
View at: Publisher Site | Google Scholar
C. Q. Zhao, M. R. Young, B. A. Diwan, T. P. Coogan, and M. P. Waalkes, “Association of arsenic-induced malignant transformation with DNA hypomethylation and aberrant gene expression,” Proceedings of the National Academy of Sciences of the United States of America, vol. 94, no. 20, pp. 10907–10912, 1997.
View at: Publisher Site | Google Scholar
H. Chen, S. Li, J. Liu, B. A. Diwan, J. C. Barrett, and M. P. Waalkes, “Chronic inorganic arsenic exposure induces hepatic global and individual gene hypomethylation: implications for arsenic hepatocarcinogenesis,” Carcinogenesis, vol. 25, no. 9, pp. 1779–1786, 2004.
View at: Publisher Site | Google Scholar
M. Takiguchi, W. E. Achanzar, W. Qu, G. Li, and M. P. Waalkes, “Effects of cadmium on DNA-(Cytosine-5) methyltransferase activity and DNA methylation status during cadmium-induced cellular transformation,” Experimental Cell Research, vol. 286, no. 2, pp. 355–365, 2003.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2019 Zhihua Ren et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Oxidative Medicine and Cellular Longevity

Toxicity of DON on GPx1-Overexpressed or Knockdown Porcine Splenic Lymphocytes In Vitro and Protective Effects of Sodium Selenite

Abstract

1. Introduction

2. Materials and Methods

2.1. Cell Treatments and Grouping

2.2. Establishment of GPx1-Overexpressing Pig Splenic Lymphocytes In Vitro

2.2.1. Construction and Verification of the Recombinant Plasmid pEGFP-N1-GPx1

2.2.2. Establishment of the Transfection Model Using Recombinant Plasmid pEGFP-N1-GPx1 in Pig Spleen Lymphocytes

2.3. Establishment of GPx1 Knockdown Pig Spleen Lymphocytes In Vitro

2.3.1. Design of GPx1-siRNA

2.3.2. Establishment of a Transfection Model for GPx-1 Knockdown Pig Splenic Lymphocytes

2.4. Determination of Antioxidant Capacity

2.5. Determination of Apoptosis

2.6. Detection of Genes Related to Methylation

2.7. Statistical Analysis

3. Results

3.1. Establishment of the Transfection Model Using Recombinant Plasmid pEGFP-N1-GPx1 in Porcine Spleen Lymphocytes

3.2. Establishment of a Transfection Model for GPx-1 Knockdown Porcine Splenic Lymphocytes

3.3. Related Index of the GPx1 Overexpression Group

3.3.1. Effect of Na2SeO3 on DON-Induced Oxidative Toxicity of GPx1-Overexpressed Splenic Lymphocytes of Pigs

3.3.2. Effect of Na2SeO3 on DON-Induced Apoptosis of GPx1-Overexpressing Splenic Lymphocytes from Pigs

3.3.3. Effect of Na2SeO3 and DON on the Expression of Methylation-Related Genes in GPx1-Overexpressing Pig Splenic Lymphocytes

3.4. Related Index of the GPx1 Knockdown Group

3.4.1. Effect of Na2SeO3 on DON-Induced Oxidative Toxicity of the GPx1 Knockdown Splenic Lymphocytes of Pigs

3.4.2. Effect of Na2SeO3 on DON-Induced Apoptosis of GPx1 Knockdown Splenic Lymphocytes of Pigs

3.4.3. Effect of Na2SeO3 on the Expression of Methylation-Related Genes Induces by DON in GPx1-Knockdown Pig Splenic Lymphocytes

4. Discussion

Data Availability

Additional Points

Conflicts of Interest

Authors’ Contributions

Acknowledgments

References

Copyright

3.3.1. Effect of Na₂SeO₃ on DON-Induced Oxidative Toxicity of GPx1-Overexpressed Splenic Lymphocytes of Pigs

3.3.2. Effect of Na₂SeO₃ on DON-Induced Apoptosis of GPx1-Overexpressing Splenic Lymphocytes from Pigs

3.3.3. Effect of Na₂SeO₃ and DON on the Expression of Methylation-Related Genes in GPx1-Overexpressing Pig Splenic Lymphocytes

3.4.1. Effect of Na₂SeO₃ on DON-Induced Oxidative Toxicity of the GPx1 Knockdown Splenic Lymphocytes of Pigs

3.4.2. Effect of Na₂SeO₃ on DON-Induced Apoptosis of GPx1 Knockdown Splenic Lymphocytes of Pigs

3.4.3. Effect of Na₂SeO₃ on the Expression of Methylation-Related Genes Induces by DON in GPx1-Knockdown Pig Splenic Lymphocytes