Research Article
Transcriptional Profiling of Exosomes Derived from Staphylococcus aureus-Infected Bovine Mammary Epithelial Cell Line MAC-T by RNA-Seq Analysis
Table 1
The sequence of primer used in this study.
| Name | Primer sequence (5-3) | GenBank accession number | Product size (bp) |
| SFMBT1 | Sense: CTAACCTCTTCGGTCCACG Antisense: CTTCACTTAGGGAATCGTCA | XM_024982617.1 | 315 | SLF2 | Sense: GAGACTAAGATACCGAAACC Antisense: GGAATACATGGCACAACT | NM_001102259.1 | 404 | LCOR | Sense: GTATTCTTGAAGGGCTGTTTG Antisense: TGATCTCACGGGCCACTAG | XM_024985881.1 | 321 | BRSK2 | Sense: GCCTCACGCTAGAGCACATTC Antisense: GGCGGGTCTATCTCGTTCC | XM_024987615.1 | 310 | PRKDC | Sense: CCTCCTGTTTGACCTTTG Antisense: TGACACTTCCCAGTTACTCC | NM_001256559.1 | 269 | FAT3 | Sense: GTATGAGAACTCGGCAGCAA Antisense: AATCCTCGCCTCGGACA | NM_001206882.1 | 257 | LOC112446130 | Sense: CCAGGGCGAGGCTTATC Antisense: AATTATGCAGTCGAGTTTCC | XR_003034201.1 | 82 | CFAP54 | Sense: GCGGGATGCCTGGTTAC Antisense: GTGGGAGACACGTTTGGTGA | XR_003034773.1 | 133 | CCNT2 | Sense: ACATCTCAGCACCCTCG Antisense: CCAGCCATTCACCCTAA | XR_003038102.1 | 433 | LOC101905593 | Sense: AGAAGGCAATGGCACCC Antisense: GACGGCAGTCCAACAGG | XR_001500758.2 | 218 | LOC112441605 | Sense: TGTTGTTGTTCCGTTGGTC Antisense: TCAGTGTTCGGTTATTTGC | XR_003029422.1 | 118 | CLCN2 | Sense: CCCGTCGTCCTCATCACTTT Antisense: TGCTTGCGATATGCACAAAA | XR_003036684.1 | 220 |
|
|