Pre-Exposure to Environmental Enrichment Protects against Learning and Memory Deficits Caused by Infrasound Exposure

Jiang, Shan; Wang, Yong-Qiang; Tang, Yi-Fei; Lu, Xi; Guo, Dan

doi:https://doi.org/10.1155/2022/6208872

Oxidative Medicine and Cellular Longevity

On this page

Abstract Introduction Materials and Methods Results Discussion Data Availability Conflicts of Interest Authors’ Contributions Acknowledgments References Copyright Related Articles

Research Article | Open Access

Volume 2022 | Article ID 6208872 | https://doi.org/10.1155/2022/6208872

Pre-Exposure to Environmental Enrichment Protects against Learning and Memory Deficits Caused by Infrasound Exposure

Shan Jiang,¹Yong-Qiang Wang,²Yi-Fei Tang,¹Xi Lu,¹and Dan Guo¹

Academic Editor: Nadja Schroder

Received21 Oct 2021

Revised28 Feb 2022

Accepted28 Apr 2022

Published17 May 2022

Abstract

With the development of industrialization in recent years, infrasound has become an important component of public noise. To date, diverse studies have revealed the negative effects of infrasound on the central nervous system (CNS), especially the learning and memory ability. It is widely reported that environmental enrichment (EE) ameliorates the learning and memory deficits in different models of brain injury. Therefore, the present study was designed to determine the possible benefits of pre-exposure to EE in preventing functional deficits following infrasound exposure and their related mechanism. Adult male rats were given enriched or standard housing for 30 days. Following enrichment, the rats were exposed to 16 Hz, 130 dB infrasound for 14 days, and then their learning and memory ability was assessed. Changes to neuroinflammation, apoptosis, and oxidative stress in the hippocampus were also detected. Our results showed that the infrasound-induced deficit in learning and memory was attenuated significantly in EE pre-exposed rats. Pre-exposure to EE could induce a decrease in proinflammatory cytokines and increased anti-inflammatory cytokines and antioxidant properties in the hippocampus. Moreover, pre-exposure to EE also exerted antiapoptosis functions by upregulating the B-cell lymphoma/leukemia-2 (Bcl-2) level and downregulating the P53 level in the hippocampus. In conclusion, the results of the present study suggested that EE is neuroprotective when applied before infrasound exposure, resulting in an improved learning and memory ability by enhancing antioxidant, anti-inflammatory, and antiapoptosis capacities.

1. Introduction

Infrasonic noise refers to acoustic oscillation with a frequency below 20 Hz, which is hard to detect by the human ear [1]. There are many natural sources of infrasonic noise, including volcanic eruptions, ocean waves, and wind [2]. Currently, modern society has greatly increased infrasound generation through man-made sources, such as occupational conditions, industrial installations, vibration of mechanical equipment inside enclosed spaces, wind turbines, and transportation [3]. Opening the rear window in a car traveling at 100 km/h for example exposes the passengers to levels of infrasound as high as 125 dB [4]. Its characteristics of strong vibration/penetration, low attenuation during long distance propagation, and difficulty in protection mean that infrasound has become an important component of noise pollution and a new health hazard to the public at large [5].

Mammalian organs’ inherent vibration frequencies are just within the range of those of infrasound; therefore, infrasound can disturb normal functions of multiple organs by triggering biological resonance [6, 7], in which the central nervous system (CNS) is the most vulnerable organ [8–10]. Substantial and growing evidence has revealed that exposure to infrasound can markedly impair the learning and memory ability of rats [9, 11]. The underlying mechanisms include enhanced neuronal apoptosis, production of proinflammatory cytokines, oxidative stress, and microglial activation in the rat hippocampus [11–13]. However, it is difficult to prevent human beings from infrasound-induced learning and memory deficit because it is detectable in most cases [14]. Thus, it is necessary to explore novel methods that effectively prevent against infrasound-induced learning and memory deficit.

Environmental enrichment (EE) is a paradigm consisting of enriched and novel housing conditions. EE has been reported to be capable of ameliorating cognitive function deficits associated with various brain injuries [15–17]. For example, EE has shown its potential protective effects against memory deficits in a rat model of traumatic brain injury (TBI) [18–20]. This effect is achieved by decreasing the level of proinflammatory cytokines (interleukin- (IL-) 1β and tumor necrosis factor alpha (TNFα)) and increasing the level of the anti-inflammatory cytokine (e.g., IL-10) [18–20]. In a rat stroke model, EE was also shown to prevent stroke-induced learning and memory disorder [21–23]. In this process, EE alleviated oxidative stress, suppressed neuroinflammation, reduced cytokines, and alleviated astroglial activation [21–23]. Our recent research also showed that EE can protect against sepsis-associated encephalopathy- (SAE-) induced learning and memory deficits by decreasing the cytokines in the hippocampus and this effect was mediated by vasopressin (VP) binding to the VP receptor 1a [24]. Although EE therapy is effective in reducing negative outcomes, its efficacy is limited by the fact that the damage has already occurred, and its usage is palliative rather than preventative. In recent years, a growing body of research has focused on the preventive effect of EE exposure before injury. Johnson and colleagues demonstrated that preinjury exposure to EE enhanced resistance against cognitive deficits caused by TBI [25]. In an experimental model of cerebral ischemia, exposure to EE before cerebral ischemia induction also exhibited a cognitive neuroprotective effect [26]. Further research showed that pre-exposure to EE can reduce the level of the inflammatory cytokines and relieve the oxidative damage that contributes to cognitive impairment [26, 27]. All these findings suggest that pre-exposure to EE might be capable of generating tolerance against infrasound-induced learning and memory impairment. However, little information is available in the literature regarding the protective effects of pre-exposure to EE against infrasound-induced learning and memory impairment.

Accordingly, the aim of the present study was to evaluate the preventive effect of pre-exposure to EE on infrasound-induced learning and memory impairment and its underlying mechanism. To this end, rats were given enriched or standard housing for 30 days, and then exposed to 16 Hz, 130 dB infrasound for 14 days. Their learning and memory abilities were then evaluated. Additionally, we detected the changes in neuroinflammation, apoptosis, and oxidative stress in the hippocampus. If it demonstrates a protective effect on learning and memory ability, pre-exposure to EE could be an effective method to protect against learning and memory deficits after infrasound pollution and could be applied in clinical practice.

2. Materials and Methods

2.1. Animals

Male Sprague-Dawley (SD) rats (200–250 g) were provided by the Animal Center of the China-Japan Friendship Hospital, Beijing, China. The experimental procedures were carried out in accordance with the Guidelines for the use of animals in neuroscience research (published in the Membership Directory of the Society, pp 27-28, 1992) and were approved by the committee of Animal Use for Research and Education of the China-Japan Friendship Hospital. The animals were housed under a 12 h light/dark cycle in a temperature-controlled room at 24 ± 1°C with free access to food and water. In addition, animals were allowed one week of acclimation to the experimental room before the experiments.

2.2. Housing Conditions

Two housing conditions were used in this study: EE conditions and standard environment conditions (SE).

SE: Rats were housed in standard-sized polycarbonate cages (25 cm ×40 cm ×20 cm), with two rats per cage located in a quiet room. The cages allowed for moderate activity and exploration.

EE: Rats were housed in a large cage (40 cm ×54 cm ×30 cm) with six rats per cage. As previously described, the cages contained multiple objects including wooden blocks, plastic bone-shaped toys, a running wheel, and a plastic tunnel [24]. Suspended ropes allowed for climbing from one level to another. Objects were replaced twice a week. During the enrichment period, food and water were available ad libitum. After 30 days of EE housing, the levels and toys were removed from the cages such that the animals no longer received additional enrichment.

2.3. Experimental Grouping

According to the results of preliminary experiments and previous studies [11, 28], the sample size for each experiment was determined.

For learning and memory testing, 24 rats were assigned in equal numbers to four groups (6 rats in each group) (Figure 1(a)): (1) the Sham-SE group. In this group, the rats were maintained under SE conditions and were then placed in the infrasonic chamber for 2 h once daily for 14 days, but without infrasound exposure (IE) (i.e., sham IE); (2) the Sham-EE group. In this group, the rats were maintained under EE conditions and then received sham IE; (3) the IE-SE group. In this group, the rats were maintained under SE conditions, placed in the infrasonic chamber, and treated with 16 Hz and 130 dB IE for 2 h once daily for 14 days; (4) the IE-EE group. In this group, the rats were maintained under EE conditions and then placed in the infrasonic chamber for and treated with 16 Hz and 130 dB IE for 2 h once daily for 14 days. For more detailed information about infrasound device and its parameters, see Section 2.4.

(a)

(b)

There were no differences in the outcomes of the Morris Water Maze (MWM) test between the Sham-EE group and Sham-SE group (see Section 3.1 and Figure 2); therefore, we only set a Sham-SE group as the control for the mechanism experiments (Figure 1(b)). Rats ( =54) were assigned in equal numbers to three groups for the mechanism experiments (18 rats in each group): the Sham-SE group, the IE-SE group, and the IE-EE group (Figure 1(b)). To investigate the mechanism of pre-exposure to EE, we detected the level of inflammatory/anti-inflammatory mediators, oxidative/antioxidant activity, apoptosis, and apoptosis-related molecules and pathway. Thus, in each group, 6 rats were used to detect the level of apoptosis and apoptosis-related molecules using Fluoro-Jade C (FJC) staining and immunofluorescent microscopy. The rats were sacrificed and brain sections containing the hippocampus were prepared for staining. Another 6 rats were used to detect the oxidative/antioxidant activity. The rats were sacrificed and the hippocampus was homogenized. Then, homogenates were tested for oxidant and antioxidant activity. Another 6 rats were used to detect the levels of inflammatory/anti-inflammatory mediators and apoptosis-related molecules using quantitative real-time reverse transcription PCR (qRT-PCR) and enzyme-linked immune-absorbent assays (ELISAs). The rats were sacrificed and their brains were divided into the two hemispheres. The hippocampus on one side was used for qRT-PCR and the hippocampus on the other side was used for ELISA.

(a)

(b)

(c)

(d)

(e)

Figure 2

(a) From day 3 onwards, the rats in the IE-SE group showed a longer latency time to the platform than the rats in the Sham-SE, Sham-EE, or IE-EE group. Sham-SE vs. IE-SE: ; IE-SE vs. IE-EE: ; IE-SE vs. Sham-EE: . (b) No differences were exhibited in the latency to the visible platform. (c) The rats in the IE-SE group spent less time in target quadrant C compared with the rats in the Sham-SE, Sham-EE, or IE-EE group. , , . (d) The rats in the IE-SE group had lower target crossing times compared with the rats in the Sham-SE, Sham-EE, or IE-EE group. , . (e) No differences were observed in the swimming speed. The assignment of order was counterbalanced across rats in this test. Data represent means ± SEM, =6.

2.4. Infrasound Device

After 30 days of housing (EE or SE), the rats were given infrasound treatment.

The infrasound device used in this study has been described in our previous study [7]. The infrasound device consists of an infrasound generator (1110B, Beijing Intensity Environment Institute, Beijing, China) with a power amplifier (No. 7101, Beijing 702 Institute of Spaceflight Co, Beijing, China), a chamber containing four loudspeakers (YD500-8XA, Nanjing Electroacoustic Equipment Co., Nanjing, China), an infrasonic sensor (ACO Pacific, Belmont, CA, USA), and a data collection system. The electric-actuated infrasound generator can generate infrasound of 16 Hz at 90–130 dB. A real-time ultra-low frequency signal acquisition system was used to collect and analyze the frequency and intensity of infrasound. The frequency and intensity of infrasound are monitored using an infrasonic sensor and displayed on the computer. The infrasonic generator system can generate standard infrasonic waves with a frequency range from 2 to 20 Hz and a sound pressure level from 90 to 140 dB. The intensity and frequency were held steady during 2 h of animal exposure and were monitored by the data collection system.

According to previous studies [7], the rats’ learning and memory abilities were most seriously affected when exposed to 16 Hz at 130 dB infrasound, and thereby this parameter was adopted in the present study. The IE-SE or IE-EE groups were exposed to infrasound of 16 Hz and 130 dB for 2 h once daily for 14 days. The Sham-SE or Sham-EE group was placed into the chamber without infrasound exposure.

2.5. Learning and Memory Testing

The MWM is widely used to detect spatial learning and reference/working memory [29, 30]. This maze comprised a dark circular tank (178 cm in diameter) that was virtually divided into four quadrants (A, B, C, D). The tank was filled with water (approximately 37 cm deep). A plexiglass platform (10.2 cm in diameter) was submerged to a depth of 2 cm below waterline (i.e., invisible to the rat) and placed approximately 28 cm from the pool wall of quadrant C. To provide external space clues, several extra-maze visual objects of different shapes and sizes were hung on the wall of the experimental room. In this test, spatial learning was detected using a 5-day block comprising of four trials per day. For each trial, the rats were placed in the pool facing the wall at random quadrants. If the rats did not climb onto the platform in 120 s, they were physically guided to it. Once they reached the platform, the rats remained on it for 30 s and were then given a 5-minute break before the next trial. As a control, the platform was raised 2 cm above the water surface (visible to the rat) on day 6 to identify the contributions of non-spatial factors. On the same day, memory retention was also measured through a single probe trial. The platform was removed, and the rats explored the tank for 30 s. The percent time spent in the target quadrant (quadrant C) and the number of crossings of the platform’s previous location were recorded.

2.6. Enzyme-Linked Immune-Absorbent Assay (ELISA)

Inflammatory mediators in the hippocampus were measured using ELISAs. Rats were killed and decapitated. Tissues were collected for ELISA as previously described [31]. Briefly, the brains were placed in a chilled matrix and microdissected on a chilled glass plate. The hippocampus was isolated, homogenized with normal saline, and centrifuged at 2000 rpm, 4°C for 10 min. The supernatants were used to detect interleukin IL-10, IL-6, IL-1β, TNF-α, BCL2 associated X, apoptosis regulator (BAX), and caspase-3 using ELISA kits (Nanjing Jiancheng Bioengineering Institute, Jiangsu, China) following the manufacturer’s instructions.

2.7. Measurement of Oxidant Activity in the Hippocampus

2.7.1. Lipid Peroxidation

To determine the extent of lipid peroxidation in hippocampal homogenates, thiobarbituric acid-reactive substances (TBARS) were determined using the method described by Mihara and Uchiyama [32], with minor modifications. Hippocampi were isolated and sonicated in 10% (w/v) using radioimmunoprecipitation assay (RIPA) buffer (Tris 50 mM pH 7.4, 1% Triton X-100, NaCl 150 mM, NaF 5 mM, 0.1% sodium dodecyl sulfate, and 1% sodium deoxycholate), to which a protease inhibitor cocktail (Sigma, St. Louis, MO, USA) was added. Homogenates were incubated on ice for 30 min and then centrifuged at 600 × g for 10 min (4°C). The supernatants were stored at -80°C until analysis. A malondialdehyde acid (MDA) standard curve was obtained by acid hydrolysis of tetraethoxypropane. The TBA-MDA reaction was carried out by incubation at 95°C for 10 min. Fluorescence was measured at an excitation wavelength of 515 nm and an emission wavelength of 548 nm.

2.7.2. Advanced Oxidation Protein Products (AOPP)

Measuring AOPP directly determines the amounts of oxidized proteins in biological samples. For AOPP determination, tissue was homogenized by sonication in cold buffer containing 50 mM NaH₂PO₄ and 1 mM EDTA at pH 7.5. Then, homogenates were centrifuged at 10,000 × g for 10 min (4°C). Spectrophotometric determination of AOPP levels was performed at 340 nm according to Barsotti’s method [33].

2.7.3. Nitric Oxide (NO)

The final and stable end products of NO in vivo are nitrates and nitrites, the sum of which (NOx) reflects the total NO production. NOx was determined using a colorimetric assay (Cayman Chemical Company, Ann Arbor, MI, USA) as described previously [34]. The nitrates in the sample homogenates were enzymatically converted into nitrites by incubation with nitrate reductase and NADPH, and total nitrite (nmol/mg protein) were then monitored using the Griess reaction at 540 nm.

2.8. Measurement of Antioxidant Activity in the Hippocampus

2.8.1. Glutathione System

Reduced glutathione (GSH) and glutathione disulfide (GSSG; oxidized glutathione) concentrations were measured in hippocampal extracts. A sample of tissue was homogenized in a cold 1 : 1 mixture of 0.1 M potassium phosphate, 5 mM EDTA (pH 6.8), and 10% metaphosphoric acid. The homogenate was incubated on ice for 30 min and then centrifuged at 100,000 × g for 30 min. The resulting supernatant was used to determine GSH and GSSG using the fluorescent probe ophthalaldehyde (OPA). Aliquots for GSSG determination were first incubated with N-ethylmaleimide, which complexes with GSH, to avoid interference. After a further 15 min of incubation with OPA, fluorescence was determined at 420 nm (excitation 350 nm). The total brain proteins were determined using the Bradford protein assay. For glutathione reductase (GR, EC 1.8.1.7) and glutathione peroxidase (GPx, EC 1.11.1.9) determinations, hippocampi were sonicated in cold buffer containing 50 mM NaH₂PO₄ and 1 mM EDTA at pH 7.5. Then, the homogenates were centrifuged at 10,000 × g for 10 min (4°C). The supernatant was used to determine either GR or GPx activity using a kit (Nanjing Jiancheng Bioengineering Institute) according to the manufacturer’s instructions.

2.8.2. Superoxide Dismutase

Hippocampal tissue was homogenized by sonication as described in Section 2.7. Then, homogenates were centrifuged at 600 × g for 10 min (4°C). The superoxide dismutase activity (SOD, EC 1.15.1.1.) was estimated from the supernatant using a kit (Nanjing Jiancheng Bioengineering Institute).

2.9. Immunofluorescent Microscopy

Rats were sacrificed by perfusion fixation, in which the animals were deeply anesthetized using an injection of sodium pentobarbital (40 mg/kg, i.p.) and perfused transcardially with 10 ml of saline, followed by 40 ml of phosphate buffer (PB; pH 7.4) containing 4% paraformaldehyde. The brains were removed immediately and placed in 0.1 M PB containing 30% sucrose overnight at 4°C. Next day, the brain samples containing the hippocampus were cut serially into coronal sections of 25 μm thickness on a freezing microtome. These brain sections were mounted onto glass slides or collected in phosphate buffered saline (PBS, pH 7.4) for staining.

To identify B-cell lymphoma/leukemia-2 (Bcl-2) or p53 protein expression, mouse anti-p53 IgG (1 : 250, Abcam, Cambridge, MA, USA) and rabbit anti-Bcl-2 IgG antibodies (1 : 200, Abcam) were used. The negative control for every experiment was constructed by replacing the primary antibodies with 1% bovine serum albumin (BSA)-PBS. Immunofluorescence staining was performed on the hippocampus sections. Briefly, the sections were incubated for 48 h at 48°C with a mixture of primary antibodies in 0.01 M PBS (pH 7.4) containing 1% normal donkey serum, 3% BSA, and 0.1% Triton X-100. Subsequently, the sections were rinsed in 0.01 M PBS (pH 7.4), and then incubated with Alexa Fluor 488 conjugated donkey antimouse IgG (1 : 500; Molecular Probes, Eugene, OR, USA) or Alexa Fluor488 conjugated donkey antirabbit IgG (1 : 500; Molecular Probes) diluted in PBS for 4 h at room temperature. After washing, the sections were mounted on gelatin-coated glass slides, and coverslipped in 0.01 M PBS (pH 7.4) containing 50% glycerine and 2.5% triethylenediamine, and examined using laser scanning confocal microscopy (LSCM).

2.10. Fluoro-Jade C Staining

We used FJC (Chemicon, Temecula, CA, USA), which can specifically stain degenerating neurons in the CNS subject to various neurotoxin insults and neurological diseases [35, 36].

Brain sections containing the hippocampus were prepared as in Section 2.9. FJC staining was carried out using the following standard procedures [35, 36]: (1) pretreatment with an alcohol-sodium hydroxide mixture. The sections were immersed in a solution containing 1% sodium hydroxide in 80% alcohol for 5 min, followed by 70% alcohol and distilled water each for 2 min. (2) Pretreatment with potassium permanganate. The sections were then transferred into a solution of 0.06% potassium permanganate for 10 min, and rinsed in distilled water for 2 min. (3) FJC staining. The sections were immersed into 0.0001% solution of FJC dye (Chemicon) dissolved in 0.1% acetic acid vehicle (pH 3.5) and stained for 10 min. (4) Post FJC treatment. The slides were washed with distilled water three times for 1 min each time and left to dry overnight in the dark at room temperature. (5) The sections were air-dried, dehydrated in ethanol, cleared in xylene, and coverslipped with DPX (distyrene, a plasticizer, and xylene). Finally, the FJC-stained sections were examined under an epifluorescence microscope or by LSCM (FluoView1000, Olympus, Tokyo, Japan). The FJC-positive staining appeared as a strong green color using the same filter system as that used for activating fluorescein.

2.11. Quantitative Real-Time Reverse Transcription PCR (qRT-PCR) Analysis

qRT-PCR analysis was performed for apoptosis-related genes in the hippocampus. The rat supraoptic nucleus (SON) or hippocampus was collected and total RNA was obtained from the tissues using the Trizol reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s protocol. The mRNA was then reverse transcribed to cDNA. The quantitative real-time PCR step was performed using the ABI 7901HT sequence detection system (Applied Biosystems, Foster City, CA, USA) using a Power SYBR green PCR Master Mix kit (Applied Biosystems) and the cDNA as the template. All the data were normalized to Actb (β-actin) expression.

The primers used were designed and synthesized by Takara (Dalian, China) and their sequences were as follows: Actb, forward primer: CACGATGGAGGGGCCGGACTCATC, reverse primer: TAAAGACCTCTATGCCAACACAGT; Bcl2 (Bcl-2), forward primer: ATGCCTTTGTGGAACTATATGGC, reverse primer: GGTATGCACCCAGAGTGATGC; p53, forward primer: AAGCCCTCCAAGTGTCAGC; reverse primer: CGTCACCATCAGAGCAACG; Bax (Bcl-2 associated X protein), forward primer: TGAAGACAGGGGCCTTTTTG, reverse primer: AATTCGCCGGAGACACTCG; and Casp3 (caspase-3), forward primer: ATGGAGAACAACAAAACCTCAGT; reverse primer: TTGCTCCCATGTATGGTCTTTAC.

2.12. Statistical Analysis

The results are expressed as the mean ± S.E.M. The data were tested for normality using the Kolmogorow–Smirnov (K-S) test. For the MWM data, the differences between the Sham-SE, Sham-EE group, IE-SE group, and IE-EE group were analyzed using two-way analysis of variance (ANOVA). For the data of FJC staining, immunofluorescent microscopy, qRT-PCR, ELISA, oxidant activity, and antioxidant activity testing, one-way ANOVA was used. When a statistically significant difference was found, Tukey’s post-hoc analysis was conducted. was considered statistically significant. The statistical analysis was performed using GraphPad Prism 9.0 software (GraphPad Inc., La Jolla, CA, USA).

3. Results

3.1. Pre-Exposure to EE Ameliorated Infrasound-Induced Learning and Memory Impairment

In this part, the effect of pre-exposure to EE on learning and memory was determined using the MWM, a hippocampus-dependent learning and memory task.

During the acquisition phase (learning testing), escape latency (latency to reach the hidden platform) was recorded for 5 consecutive days. The findings revealed that the Sham-SE rats, the Sham-EE rats, and IE-EE rats performed better in terms of escape latency than the IE-SE rats at days 3, 4, and 5, suggesting that pre-EE housing ameliorated the infrasound-induced impairment of learning (at day 3: IE factor F (1, 20) =64.7, ; environmental factor F (1, 20) =0.3513, ; interaction F (1, 20) =9.290, ; at day 4: IE factor F (1, 20) =54.90, ; environmental factor F (1, 20) =29.91, ; interaction F (1, 20) =15.45, ; at day 5: IE factor F (1, 20) =84.60, ; environmental factor F (1, 20) =70.85, ; interaction F (1, 20) =111.0, . Post-hoc analysis: Sham-SE vs. IE-SE group: day 3: , day 4: , day 5: ; Sham-EE vs. IE-SE group: day 3: , day 4: , day 5: ; IE-EE vs. IE-SE group: day 3: , day 4: , day 5: ; Figure 2(a)). In addition, latency to the visible platform was also recorded at day 6. The results showed no significant differences among the three groups (IE factor F (1, 20) =0.7492, ; environmental factor F (1, 20) =0.01529, ; interaction F (1, 20) =0.01529, ; Figure 2(b)), confirming that vision was not responsible for the differences observed in escape latencies. The above results suggested that pre-exposure to EE ameliorated infrasound-induced learning deficits.

At day 6, the platform was removed and time spent in quadrant C and crossing times of the platform zone were recorded and analyzed for reference/working memory retention. The results showed that the rats in the Sham-SE, Sham-EE, and IE-EE group displayed enhanced memory retention, as demonstrated by a greater percentage of allotted time spent in quadrant C, when compared with the IE-SE rats (IE factor F (1, 20) =32.27, ; environmental factor F (1, 20) =9.468, ; interaction F (1, 20) =0.8964, . Post-hoc analysis: Sham-SE vs. IE-SE group: ; Sham-EE vs. IE-SE group: ; IE-SE vs. IE-EE group: ; Figure 2(c)), suggesting that pre-exposure to EE relieved infrasound-induced memory impairment. The results of the crossing times of the platform zone showed similar results. The rats in the Sham-SE, Sham-EE, and IE-EE group crossed the platform zone more often than those in the IE-SE group (IE factor F (1, 20) =14.31, ; environmental factor F (1, 20) =5.990, ; interaction F (1, 20) =8.366, . Post-hoc analysis: Sham-SE vs. IE-SE group: ; Sham-EE vs. IE-SE group: ; IE-SE vs. IE-EE group: ; Figure 2(d)).

Lastly, no significant differences in swimming speed were observed among the three groups (IE factor F (1, 20) =0.052, ; environmental factor F (1, 20) =1.536, ; interaction F (1, 20) =0.608, ; Figure 2(e)), indicating that no motor deficits contributed to the above differences.

No differences were shown between the Sham-EE group and Sham-SE group in the learning and memory testing, which indicated that environmental factors had no effect on the sham rats. Thus, to highlight the mechanisms underlying the positive effect of pre-exposure to EE on the learning and memory ability under IE conditions, we only set a Sham-SE group as the control in the following mechanism experiments.

3.2. Pre-Exposure to EE Inhibited Inflammatory Cytokines but Enhanced Anti-Inflammatory Cytokines

In the hippocampus, accumulating evidence has demonstrated that inflammatory mediators play important roles in the impairment of learning and memory [37–40]. Accordingly, in the present study, we examined the changes of inflammatory mediators in the hippocampus.

Compared with that in the Sham-SE group, there was an increase in IL-1β, IL-6, TNF-α, and IL-10 levels in the hippocampus of the IE-SE rats (Sham-SE vs. IE-SE group: IL-1β: , IL-6: , TNF-α: , IL-10: ; Figures 3(a)–3(d)). At the same time, the levels of IL-1β, IL-6, and TNF-α in the IE-EE group were also lower than those in the IE-SE group (IE-SE vs. IE-EE group: IL-1β: , IL-6: , TNF-α: , Figures 3(a)–3(d)). In contrast, as an anti-inflammatory cytokine, the IL-10 level in the IE-EE group exhibited an increased trend when compared with that in the IE-SE group (IE-SE vs. IE-EE group: IL-10: ; Figures 3(a)–3(d)), indicating that pre-EE housing skewed the IE-induced proinflammatory profile towards an anti-inflammatory profile in the hippocampus.

(a)

(b)

(c)

(d)

Figure 3

(a) The IL-1β level in the hippocampus in the IE-SE group was higher than that in the Sham-SE or IE-EE group. (b) The IL-6 level in the hippocampus in the IE-SE group was higher than that in the Sham-SE or IE-EE group. (c) The TNFα level in the hippocampus in the IE-SE group was higher than that in the Sham-SE or IE-EE group. (d) The IL-10 level in the hippocampus in the IE-SE group was higher than that in the Sham-SE group and was lower than that in the IE-EE group. , , , . Data represent means ± SEM, =6.

Taken together, these results suggested that pre-exposure to EE induced a decrease in proinflammatory cytokines and an increase in anti-inflammatory cytokines.

3.3. Pre-Exposure to EE Decreased Oxidative Stress in the Hippocampus

It is widely reported that oxidative stress is responsible for the learning and memory impairment in various pathological conditions [41, 42]. In this part, we detected the changes in oxidant activity in the hippocampus.

In the IE-SE group, there was a significant increase in TBARS level when compared with that in the Sham-SE group (Sham-SE vs. IE-SE group: ; Figure 4(a)), while the TBARS level in the IE-EE group did not differ significantly from that in the Sham-SE group and was lower than that in the IE-SE group (IE-SE vs. IE-EE group: ; Figure 4(a)).

(a)

(b)

(c)

A similar response was found for AOPP (Figure 4(b)). After infrasound exposure, the AOPP level in the hippocampus of the IE-SE group was significantly higher than that in the Sham-SE group (Sham-SE vs. IE-SE group: ; Figure 4(b)). Again, the IE-EE group also presented a lower AOPP level compared with that in the IE-SE group (IE-SE vs. IE-EE group: ; Figure 4(b)).

In this study, we also detected the changes in NOx. As expected, IE also induced a significant increase in the level of NOx compared with that in the Sham-SE group (Sham-SE vs. IE-SE group: ; Figure 4(c)). However, for the rats subjected to pre-exposure to EE and IE, the NOx level returned to basal values and showed no difference with that in the Sham-SE group (IE-SE vs. IE-EE group: ; Figure 4(c)).

Analysis of the markers of oxidative stress showed that exposure to infrasound caused significant oxidative stress, which could be inhibited by pre-exposure to EE.

3.4. Pre-Exposure to EE Enhanced Antioxidant Activity in the Hippocampus

Oxidative stress depends on the balance between antioxidant and oxidant elements. Considering that IE increased hippocampal oxidative stress, the present results also showed that IE led to a significant decrease in the principal antioxidant molecules in the hippocampus, GSH, and SOD.

GSH was oxidized after IE, with a reduction in its hippocampal level when compared with that in the Sham-SE group (Sham-SE group vs. IE-SE group: , Figure 5(a)). Correspondingly, after IE, an increase in GSSG was found in the hippocampus (Sham-SE vs. IE-SE group: ; Figure 5(b)), which resulted in a decrease in the oxidized GSH/GSSG ratio in the IE-SE group (Sham-SE vs. IE-SE group: ; Figure 5(c)). However, after pre-exposure to EE, the decrease in GSH and the increase in GSSG caused by IE were inhibited (IE-SE vs. IE-EE group: GSH: , GSSG: ; Figures 5(a) and 5(b)), leading to a relative higher GSH/GSSG ratio (IE-SE vs. IE-EE group: ; Figure 5(c)).

(a)

(b)

(c)

(d)

Another important enzyme with antioxidant activity is superoxide dismutase (SOD), which showed a significant decrease in the IE-SE group (Sham-SE vs. IE-SE group: ; Figure 5(d)). However, in the IE-EE group, the SOD activity in the hippocampus was restored during IE (IE-SE vs. IE-EE group: ; Figure 5(d)).

3.5. Pre-Exposure to EE Regulated Apoptosis-Related Molecules

Exposure to infrasound causes a significant increase in apoptosis, which also contributes to the impairment of learning and memory. P53 and Bcl-2 have been shown to regulate the apoptotic processes in opposite manners [43–45].

As shown in Figure 6(a), p53-positive neurons were present in the hippocampus. In the Sham-SE group, the mean number of p53-positive neurons was about 2.83 ± 0.87 (Figures 6(a) and 6(b)). However, in the IE-SE group, the mean number of p53-positive neurons increased significantly to 17.17 ± 1.32, whereas this increase was inhibited in the IE-EE rats (9.50 ± 0.88) (Sham-SE vs. IE-EE group: ; IE-SE vs. IE-EE group: (Figures 6(a) and 6(b)). However, the number of Bcl-2-positive neurons showed the reverse change: after IE, the mean number of Bcl-2-positive neurons significantly decreased from 22.50 ± 0.87 to 8.33 ± 1.28 (Sham-SE vs. IE-SE group: , Figures 7(a) and 7(b)). As expected, in the IE-EE group, the mean number of Bcl-2-positive neurons was partially restored to 16.00 ± 1.46, which was higher than that in the IE-SE group (IE-SE vs. IE-EE group: , Figures 7(a) and 7(b)). These results suggested that EE is capable of ameliorating the IE-induced increase in p53-positive neurons and the decrease in Bcl-2-positive neurons. Moreover, the results from ELISA experiments also showed increased p53 or decreased Bcl-2 protein levels in the hippocampus after IE, and pre-exposure to EE could neutralize these changes to the p53 and Bcl-2 levels caused by IE (p53: Sham-SE vs. IE-EE group: , Sham-SE vs. IE-EE group: ; IE-SE vs. IE-EE group: ; Bcl-2: Sham-SE vs. IE-SE group: , Sham-SE vs. IE-EE group: ; IE-SE vs. IE-EE group: ; Figures 6(c) and 7(c)).

(a)

(b)

(c)

(d)

Figure 6

(a) P53 staining in the hippocampus in the Sham-SE, IE-SE, and IE-EE groups. (b) The number of p53-positive neurons in the hippocampus in the IE-SE group was significantly higher than that in the Sham-SE or IE-EE group. (c) The p53 protein level in the hippocampus in the IE-SE group was significantly higher than that in the Sham-SE or IE-EE group. (d) The p53 mRNA level in the hippocampus in the IE-SE group was significantly higher than that in the Sham-SE or IE-EE group. , , . Data represents means ± SEM, =6.

(a)

(b)

(c)

(d)

Figure 7

(a) Bcl-2 staining in the hippocampus in the Sham-SE, IE-SE, and IE-EE groups. (b) The number of Bcl-2-positive neurons in the hippocampus in the IE-SE group was significantly lower than that in the Sham-SE or IE-EE group. (c) The Bcl-2 protein level in the hippocampus in the IE-SE group was significantly lower than that in the Sham-SE or IE-EE group. (d) The Bcl2 mRNA level in the hippocampus in the IE-SE group was significantly lower than that in the Sham-SE or IE-EE group. , , . Data represent means ± SEM, =6.

Previous studies have shown that Bcl-2 reduced apoptosis by influencing Bax and caspase-3 [28]. Therefore, we also detected the changes in Bax and caspase-3 in the hippocampus using ELISA. As expected, infrasound exposure increased the levels of Bax and caspase-3 (Bax: Sham-SE vs. IE-SE group: , caspase-3: Sham-SE vs. IE-SE group: ; Figures 8(a) and 8(c)) and pre-exposure to EE could inhibit the increase in the levels of Bax and caspase-3 (Bax: IE-SE vs. IE-EE group: , caspase-3: IE-SE vs. IE-EE group: ; Figures 8(a) and 8(c)).

(a)

(b)

(c)

(d)

Figure 8

(a) The Bax level in the hippocampus in the IE-SE group was higher than that in the Sham-SE or IE-EE group. (b) The Bax mRNA level in the hippocampus in the IE-SE group was higher than that in the Sham-SE or IE-EE group. (c) The caspase-3 level in the hippocampus in the IE-SE group was higher than that in the Sham-SE or IE-EE group. (d) The Casp3 mRNA level in the hippocampus in the IE-SE group was higher than that in the Sham-SE or IE-EE group. , , . Data represent means ± SEM, =6.

qRT-PCR showed similar results. IE induced increases in P53, Bax, and Casp3 expression, but a decrease in Bcl2 expression in the hippocampus, which could be blocked by pre-EE housing (p53: Sham-SE vs. IE-SE group: , IE-SE vs. IE-EE group: ; Bcl2: Sham-SE vs. IE-SE group: , IE-SE vs. IE-EE group: ; Bax: Sham-SE vs. IE-SE group: , IE-SE vs. IE-EE group: ; casp3: Sham-SE vs. IE-SE group: , IE-SE vs. IE-EE group: ; Figures 6(d), 7(d), and 8(b) and 8(d)).

Thus, pre-exposure to EE exhibited antiapoptosis activity under infrasound exposure conditions by affecting the levels of p53 and the Bcl-2/Bax/caspase-3 signaling pathway.

3.6. Pre-Exposure to EE Inhibited the Apoptotic Response to IE

In the present study, apoptotic neurons were stained using FJC dye in the hippocampus. As shown in Figure 9, the FJC-positive cells were clearly observed in the hippocampal pyramidal layer and granular cells of the dentate gyrus. In the Sham-SE group, no FJC-positive neurons were detected in the hippocampus (Figures 9(a) and 9(b)). However, in the IE-SE group, the mean number of FJC-positive neurons dramatically increased to 30.17 ± 2.74 (Sham-SE vs. IE-SE group: ; Figures 9(a) and 9(b)). Furthermore, in the IE-EE group, the mean number of FJC-positive neurons was 16.50 ± 1.61, which was less than that in the IE-SE group (IE-SE vs. IE-EE group: ; Figures 9(a) and 9(b)). These results suggested that infrasound enhanced apoptosis in the hippocampus, which could be inhibited by pre-exposure to EE.

(a)

(b)

4. Discussion

The results of the present study provided evidence that 30 days of EE before infrasound treatment protects learning and memory, as indicated by the results of the MWM test. Animals pretreated with EE has better prognosis following infrasound exposure. This is likely achieved by enhancing antioxidant, anti-inflammatory, and antiapoptosis capacities.

In the present study, we used the MWM to evaluate the learning and memory ability. The MWM is widely used to assess hippocampus-dependent spatial learning and memory and is closely related to hippocampal long-term potentiation (LTP) [46–48]. In the present study, the increased escape latency, less time in target quadrant C, and reduced target crossing times after IE indicated impaired learning and memory, which were consistent with the results of previous studies [7, 11]. Our study also revealed that pre-exposure to EE was capable of counteracting the infrasound-induced impairment of learning and memory. We noticed that the rats swam at about the same speed in the pool among the groups, suggesting that no locomotor factor disturbed their performance in the MWM. In addition, land-based locomotor impairment is not related to swimming speed, which also accounts for the independence of learning and memory performance in the MWM from locomotor effects.

Neuroinflammation plays important roles in learning and memory deficits under pathological conditions [49–51]. In the present study, we demonstrated that after infrasound exposure, the levels of IL-1β, IL-6, and TNF-α increased significantly, which were consistent with the results of previous studies [11, 12]. As a proinflammatory cytokine, an increased IL-1β level inhibits LTP in the hippocampus by affecting Ca²⁺ conductance through N-methyl-D-aspartate receptors (NMDARs) [52]. In increased IL-6 level also impairs the LTP by decreasing extracellular regulated kinase (ERK)1/2 activation in the hippocampus [53]. Moreover, increased hippocampal TNFα concentrations can block glutamate transporter activity and promote glutamate neurotoxicity, eventually leading to an impaired LTP [54]. Therefore, our results indicated that IE might impair the learning and memory ability by increasing these proinflammatory cytokines. By contrast, IL-10 is the most important anti-inflammatory cytokine, which counteracts the damage caused by excessive inflammation. In this study, we found that infrasound exposure induced an obvious increase in anti-inflammatory cytokine (IL-10). By acting on the IL-10 receptor in neurons, IL-10 facilitates the LTP via regulation of GABA_B synaptic transmission, thereby increasing the learning and memory ability [55]. The increase in IL-10 might be the result of a self-protection mechanism against infrasound exposure. In addition, the present study found that EE pre-exposure counteracted the IE-induced change in inflammatory mediators in the hippocampus, suggesting a positive effect of EE on the learning and memory ability under IE conditions. In fact, it has been reported that EE affects cytokines, various immune components, and glial cells under various pathological conditions [24, 56–58]. The antineuroinflammatory effect of EE might be achieved through several immune pathways [59, 60]: (i) increased migration of macrophages into the CNS and enhancement of their regulatory effects on microglia; (ii) upregulation of mitogen-activated protein kinase (MAPK) phosphatase-1 (MKP-1), which exhibits negatively regulatory roles in proinflammatory macrophage MAPK activation; and (iii) modulation of hippocampal T cells, which are responsible for the modulation of microglia. Accordingly, we will investigate the effect of EE pre-exposure on these immune pathways under infrasound exposure conditions in a future study.

The present study also indicated that TBARS and AOPP (markers of oxidative stress) increased after infrasound exposure and EE pre-exposure could reduce these increases in oxidative stress. Past studies have shown that increased learning and memory performance in rats is related to a decrease in hippocampal oxidative stress [61–63]. For example, amyloid β (Aβ) can induce spatial learning and memory impairment that can be inhibited by blocking the increase in oxidative stress [64]. Therefore, in the present study, we propose the improvement of learning and memory caused by EE pre-exposure function by decreasing oxidative stress.

Under physiological conditions, there is a balance between oxidative stress and the antioxidant system. In the present study, infrasound reduced the amount of GSH in the hippocampus and increased the amount of GSSG, with a consequent reduction of the GSH/GSSG ratio, indicating lower scavenging capacity of the glutathione system in the hippocampus. Besides the reduced GSH/GSSG ratio, the SOD level was also suppressed by infrasound. SOD can catalyze superoxide anions into oxygen and hydrogen peroxide [65], which has an important protective role against the effects of reactive oxygen species (ROS). These results agree with some previous studies [9, 11]. In this study, we found that pre-exposure to EE was effective to block the infrasound-induced decrease in the GSH/GSSG ratio and SOD level in the hippocampus, indicating that EE pre-exposure improved the antioxidant system. Oxidative stress increases the production of ROS in the brain, which plays a positive role in modulating the production of proinflammatory mediators by preventing MAPK and nuclear factor kappa B (NF-κB) activation in microglia cells [66]. Therefore, we concluded that EE pre-exposure skews the infrasound-induced increase in oxidative stress and decreased the antioxidant system, resulting in a decrease in proinflammatory cytokines.

Infrasound induces neuronal apoptosis, which is also associated with learning and memory deficiency [67–69]. The present study observed that pre-exposure to EE inhibited neuronal apoptosis in the hippocampus, suggesting antiapoptosis as one of the mechanisms underlying EE pre-exposure blockade of infrasound-induced impairment of learning and memory. Our results also showed that pre-exposure to EE could inhibit the infrasound-induced increase in p53 and decrease in Bcl-2. The p53 protein mainly regulates cell-cycle arrest, senescence, and apoptosis [70, 71]. Clearly, stress or trauma can lead to p53 activation [72]. Therefore, as a background stressor, infrasound activates p53, which results in increased apoptosis in the hippocampus. Unlike p53, Bcl-2 is a small intracellular nonglycosylated protein that inhibits the apoptotic pathway when overexpressed in cells [73]. Our study also demonstrated a significant inverse relationship between Bcl-2 and p53 protein levels in the hippocampus after infrasound treatment. This finding is in line with previous studies about relationship between Bcl-2 and p53 protein levels [74]. There is also the crosstalk between Bcl-2/p53 and inflammatory mediators. For example, activation NF-κB/p53 signaling can enhance the increase in inflammatory mediators [75], while Bcl-2 exerts an anti-inflammatory function through inhibition of NF-κB [76].

This study had some limitation: (1) We assessed the learning and memory ability, detected cytokine levels, oxidative stress, antioxidant activity, apoptosis-related molecules, and apoptosis only at a single time point (i.e., after 14 days of infrasound exposure). In a future study, we will measure the above indices at different exposure times to determine the temporal effect of pre-exposure to EE. (2) In the mechanism experiments, we only set a Sham-SE group as the control. Although there were no differences between the Sham-EE group and Sham-SE group in the outcome of the MWM, a Sham-EE group should have been included in the mechanism experiments. Nonetheless, the primary aim of mechanism experiments was to identify the mechanisms underlying the effect of pre-exposure to EE on the learning and memory ability under IE conditions. The evidence from the present experimental design was sufficient to determine the possible mechanisms underlying this process. In addition, past studies also revealed no differences in the level of inflammatory factors between the Sham-EE group and Sham-SE group [77, 78]. (3) Besides the enriched and novel environment, EE housing is also accompanied by social enrichment and intermittent physical exercise in animal experiments, which are known to promote neuroprotection [79]. Therefore, we did not rule out the role of social enrichment or physical exercise in the pre-exposure to EE-induced improvement of learning and memory in the present study. A recent study showed that EE and physical exercise have better neuroprotective effects than social enrichment in memory deficits related to amyloid β (Aβ) neurotoxicity in an Alzheimer’s (AD) disease model [79].

In conclusion, the results of the present study showed that pre-exposure to EE is effective to ameliorate the learning and memory impairment caused by infrasound exposure. This process is related to a decrease in proinflammatory cytokines, oxidative stress, and apoptosis, and an increase in anti-inflammatory cytokines and antioxidant activity. The exact molecular mechanism will be explored in a future study. Therefore, these results supported the view that pre-exposure to EE could be a viable training mechanism to improve resilience against the consequences of infrasound.

Data Availability

All data can be available on the inquiry for the corresponding authors.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Authors’ Contributions

Shan Jiang and Yong-Qiang Wang contributed equally to this work.

Acknowledgments

This study was supported by the Natural Science Foundation of Beijing Municipality (CN) (Grant No.7212102), National Natural Science Foundation of China (CN) (Grant No.81201514 and Grant No.81472168), and Elite Medical Professionals project of China-Japan Friendship Hospital (Grant No.ZRJY2021-BJ04).

References

L. Ascone, C. Kling, J. Wieczorek, C. Koch, and S. Kühn, “A longitudinal, randomized experimental pilot study to investigate the effects of airborne infrasound on human mental health, cognition, and brain structure,” Scientific Reports, vol. 11, no. 1, p. 3190, 2021.
View at: Publisher Site | Google Scholar
G. Averbuch, J. D. Assink, and L. G. Evers, “Long-range atmospheric infrasound propagation from subsurface sources,” The Journal of the Acoustical Society of America, vol. 147, no. 2, pp. 1264–1274, 2020.
View at: Publisher Site | Google Scholar
R. Chaban, A. Ghazy, E. Georgiade, N. Stumpf, and C. F. Vahl, “Negative effect of high-level infrasound on human myocardial contractility: in-vitro controlled experiment,” Noise & Health, vol. 23, no. 109, pp. 57–66, 2021.
View at: Publisher Site | Google Scholar
S. Ziaran, “The assessment and evaluation of low-frequency noise near the region of infrasound,” Noise & Health, vol. 16, no. 68, p. 10, 2014.
View at: Publisher Site | Google Scholar
C. Baliatsas, I. van Kamp, R. van Poll, and J. Yzermans, “Health effects from low-frequency noise and infrasound in the general population: is it time to listen? A systematic review of observational studies,” Science of the Total Environment, vol. 557-558, pp. 163–169, 2016.
View at: Publisher Site | Google Scholar
H. Cheng, B. Wang, C. Tang et al., “Infrasonic noise induces axonal degeneration of cultured neurons via a Ca²⁺ influx pathway,” Toxicology Letters, vol. 212, no. 2, pp. 190–197, 2012.
View at: Publisher Site | Google Scholar
M. Shi, F. Du, Y. Liu et al., “Glial cell-expressed mechanosensitive channel TRPV4 mediates infrasound-induced neuronal impairment,” Acta Neuropathologica, vol. 126, no. 5, pp. 725–739, 2013.
View at: Publisher Site | Google Scholar
M. Weichenberger, M. Bauer, R. Kühler et al., “Altered cortical and subcortical connectivity due to infrasound administered near the hearing threshold - evidence from fMRI,” PLoS One, vol. 12, no. 4, article e0174420, 2017.
View at: Publisher Site | Google Scholar
H. Wang, J. Wang, Q. Yang et al., “Synthesis of a novel nitronyl nitroxide radical and determination of its protective effects against infrasound-induced injury,” Neurochemical Research, vol. 40, no. 7, pp. 1526–1536, 2015.
View at: Publisher Site | Google Scholar
L. H. Zou, Y. J. Shi, H. He et al., “Effects of FGF2/FGFR1 pathway on expression of A1 astrocytes after infrasound exposure,” Frontiers in Neuroscience, vol. 13, p. 429, 2019.
View at: Publisher Site | Google Scholar
X. Zhou, Q. Yang, F. Song et al., “Tetrahydroxystilbene glucoside ameliorates infrasound-induced central nervous system (CNS) injury by improving antioxidant and anti-inflammatory capacity,” Oxidative Medicine and Cellular Longevity, vol. 2020, Article ID 6576718, 12 pages, 2020.
View at: Publisher Site | Google Scholar
Y. J. Shi, M. Shi, L. J. Xiao et al., “Inhibitive effects of FGF2/FGFR1 pathway on astrocyte-mediated inflammation in vivo and in vitro after infrasound exposure,” Frontiers in Neuroscience, vol. 12, p. 582, 2018.
View at: Publisher Site | Google Scholar
J. Cai, D. Jing, M. Shi et al., “Epigallocatechin gallate (EGCG) attenuates infrasound-induced neuronal impairment by inhibiting microglia-mediated inflammation,” The Journal of Nutritional Biochemistry, vol. 25, no. 7, pp. 716–725, 2014.
View at: Publisher Site | Google Scholar
R. Sabatini, O. Marsden, C. Bailly, and C. Bogey, “A numerical study of nonlinear infrasound propagation in a windy atmosphere,” The Journal of the Acoustical Society of America, vol. 140, no. 1, pp. 641–656, 2016.
View at: Publisher Site | Google Scholar
M. Rojas-Carvajal, A. Sequeira-Cordero, and J. C. Brenes, “The environmental enrichment model revisited: a translatable paradigm to study the stress of our modern lifestyle,” The European Journal of Neuroscience, vol. 2021, 2021.
View at: Publisher Site | Google Scholar
L. E. Durán-Carabali, F. K. Odorcyk, E. F. Sanches, M. M. de Mattos, F. Anschau, and C. A. Netto, “Effect of environmental enrichment on behavioral and morphological outcomes following neonatal hypoxia-ischemia in rodent models: a systematic review and meta-analysis,” Molecular Neurobiology, vol. 59, no. 3, pp. 1970–1991, 2022.
View at: Publisher Site | Google Scholar
D. Cutuli, E. Landolfo, L. Petrosini, and F. Gelfo, “Environmental enrichment effects on the brain-derived neurotrophic factor expression in healthy condition, Alzheimer's disease, and other neurodegenerative disorders,” Journal of Alzheimer's Disease, vol. 85, no. 3, pp. 975–992, 2022.
View at: Publisher Site | Google Scholar
D. S. Alwis, E. B. Yan, V. Johnstone et al., “Environmental enrichment attenuates traumatic brain injury: induced neuronal hyperexcitability in supragranular layers of sensory cortex,” Journal of Neurotrauma, vol. 33, no. 11, pp. 1084–1101, 2016.
View at: Publisher Site | Google Scholar
J. B. Redell, M. E. Maynard, E. L. Underwood, S. M. Vita, P. K. Dash, and N. Kobori, “Traumatic brain injury and hippocampal neurogenesis: functional implications,” Experimental Neurology, vol. 331, article 113372, 2020.
View at: Publisher Site | Google Scholar
B. L. Tang, “Axon regeneration induced by environmental enrichment- epigenetic mechanisms,” Neural Regeneration Research, vol. 15, no. 1, pp. 10–15, 2020.
View at: Publisher Site | Google Scholar
R. G. Mestriner, L. Saur, P. B. Bagatini et al., “Astrocyte morphology after ischemic and hemorrhagic experimental stroke has no influence on the different recovery patterns,” Behavioural Brain Research, vol. 278, pp. 257–261, 2015.
View at: Publisher Site | Google Scholar
Y. S. Guo, M. Yuan, Y. Han, X. Y. Shen, Z. K. Gao, and X. Bi, “Effects of enriched environment on microglia and functional white matter recovery in rats with post stroke cognitive impairment,” Neurochemistry international, vol. 154, Article ID 105295, 2022.
View at: Google Scholar
X. Zhang, M. Yuan, S. Yang et al., “Enriched environment improves post-stroke cognitive impairment and inhibits neuroinflammation and oxidative stress by activating Nrf2-ARE pathway,” The International Journal of Neuroscience, vol. 131, no. 7, pp. 641–649, 2021.
View at: Publisher Site | Google Scholar
S. Jiang, Y. Q. Wang, Y. Tang, X. Lu, and D. Guo, “Environmental enrichment protects against sepsis-associated encephalopathy-induced learning and memory deficits by enhancing the synthesis and release of vasopressin in the supraoptic nucleus,” Journal of Inflammation Research, vol. 15, pp. 363–379, 2022.
View at: Publisher Site | Google Scholar
E. M. Johnson, K. L. Traver, S. W. Hoffman, C. R. Harrison, and J. P. Herman, “Environmental enrichment protects against functional deficits caused by traumatic brain injury,” Frontiers in Behavioral Neuroscience, vol. 7, p. 44, 2013.
View at: Publisher Site | Google Scholar
L. V. Gonçalves, A. L. Herlinger, T. A. A. Ferreira, J. B. Coitinho, R. G. W. Pires, and C. Martins-Silva, “Environmental enrichment cognitive neuroprotection in an experimental model of cerebral ischemia: biochemical and molecular aspects,” Behavioural Brain Research, vol. 348, pp. 171–183, 2018.
View at: Publisher Site | Google Scholar
K. Yu, Y. Wu, Y. Hu et al., “Neuroprotective effects of prior exposure to enriched environment on cerebral ischemia/reperfusion injury in rats: the possible molecular mechanism,” Brain Research, vol. 1538, pp. 93–103, 2013.
View at: Publisher Site | Google Scholar
D. Coimbra-Costa, N. Alva, M. Duran, T. Carbonell, and R. Rama, “Oxidative stress and apoptosis after acute respiratory hypoxia and reoxygenation in rat brain,” Redox Biology, vol. 12, pp. 216–225, 2017.
View at: Publisher Site | Google Scholar
R. Morris, “Developments of a water-maze procedure for studying spatial learning in the rat,” Journal of Neuroscience Methods, vol. 11, no. 1, pp. 47–60, 1984.
View at: Publisher Site | Google Scholar
L. B. Tucker, A. G. Velosky, and J. T. McCabe, “Applications of the Morris water maze in translational traumatic brain injury research,” Neuroscience and Biobehavioral Reviews, vol. 88, pp. 187–200, 2018.
View at: Publisher Site | Google Scholar
V. M. Porterfield, K. M. Gabella, M. A. Simmons, and J. D. Johnson, “Repeated stressor exposure regionally enhances beta-adrenergic receptor- mediated brain IL-1β production,” Brain, Behavior, and Immunity, vol. 26, no. 8, pp. 1249–1255, 2012.
View at: Publisher Site | Google Scholar
M. Mihara and M. Uchiyama, “Determination of malonaldehyde precursor in tissues by thiobarbituric acid test,” Analytical Biochemistry, vol. 86, no. 1, pp. 271–278, 1978.
View at: Publisher Site | Google Scholar
A. Barsotti, P. Fabbi, M. Fedele et al., “Role of advanced oxidation protein products and Thiol ratio in patients with acute coronary syndromes,” Clinical Biochemistry, vol. 44, no. 8-9, pp. 605–611, 2011.
View at: Publisher Site | Google Scholar
J. Castillo, R. Rama, and A. Dávalos, “Nitric oxide-related brain damage in acute ischemic stroke,” Stroke, vol. 31, no. 4, pp. 852–857, 2000.
View at: Publisher Site | Google Scholar
T. Ikenari, T. Kawaguchi, R. Ota, M. Matsui, R. Yoshida, and T. Mori, “Improvement in double staining with Fluoro-Jade C and fluorescent immunostaining: FJC staining is not specific to degenerating mature neurons,” The Journal of Histochemistry and Cytochemistry, vol. 69, no. 9, pp. 597–610, 2021.
View at: Publisher Site | Google Scholar
W. Si, B. Li, C. Lenahan et al., “AT1R/GSK-3β/mTOR signaling pathway involved in angiotensin II-induced neuronal apoptosis after HIE both in vitro and in vivo,” Oxidative Medicine and Cellular Longevity, vol. 2020, Article ID 8864323, 14 pages, 2020.
View at: Publisher Site | Google Scholar
G. I. Kartalou, A. R. Salgueiro-Pereira, T. Endres et al., “Anti-inflammatory treatment with FTY720 starting after onset of symptoms reverses synaptic deficits in an AD mouse model,” International Journal of Molecular Sciences, vol. 21, no. 23, p. 8957, 2020.
View at: Publisher Site | Google Scholar
J. Li, X. Y. Cheng, H. Yang et al., “Matrine ameliorates cognitive deficits via inhibition of microglia mediated neuroinflammation in an Alzheimer's disease mouse model,” Die Pharmazie, vol. 75, no. 7, pp. 344–347, 2020.
View at: Publisher Site | Google Scholar
Z. Zhou, J. Hou, Y. Mo et al., “Geniposidic acid ameliorates spatial learning and memory deficits and alleviates neuroinflammation via inhibiting HMGB-1 and downregulating TLR4/2 signaling pathway in APP/PS1 mice,” European Journal of Pharmacology, vol. 869, article 172857, 2020.
View at: Publisher Site | Google Scholar
J. M. Bourgognon and J. Cavanagh, “The role of cytokines in modulating learning and memory and brain plasticity,” Brain and Neuroscience Advances, vol. 4, 2020.
View at: Publisher Site | Google Scholar
L. Hou, F. Sun, R. Huang, W. Sun, D. Zhang, and Q. Wang, “Inhibition of NADPH oxidase by apocynin prevents learning and memory deficits in a mouse Parkinson's disease model,” Redox Biology, vol. 22, article 101134, 2019.
View at: Publisher Site | Google Scholar
Y. A. Bali, N. E. Kaikai, S. Ba-M'hamed, and M. Bennis, “Learning and memory impairments associated to acetylcholinesterase inhibition and oxidative stress following glyphosate based-herbicide exposure in mice,” Toxicology, vol. 415, pp. 18–25, 2019.
View at: Publisher Site | Google Scholar
C. Kizmazoglu, H. E. Aydin, I. E. Sevin, O. Kalemci, N. Yüceer, and M. A. Atasoy, “Neuroprotective effect of resveratrol on acute brain ischemia reperfusion injury by measuring annexin V, p53, Bcl-2 levels in rats,” Journal of Korean Neurosurgical Association, vol. 58, no. 6, pp. 508–512, 2015.
View at: Publisher Site | Google Scholar
M. Wang, H. Hayashi, I. Horinokita et al., “Neuroprotective effects of Senkyunolide I against glutamate-induced cells death by attenuating JNK/caspase-3 activation and apoptosis,” Biomedicine & Pharmacotherapy, vol. 140, article 111696, 2021.
View at: Publisher Site | Google Scholar
Y. Zhang, X. Guo, G. Wang et al., “Effects of rhodioloside on the neurological functions of rats with total cerebral ischemia/reperfusion and cone neuron injury in the hippocampal CA1 region,” PeerJ, vol. 8, article e10056, 2020.
View at: Publisher Site | Google Scholar
E. I. Moser, K. A. Krobert, M. B. Moser, and R. G. Morris, “Impaired spatial learning after saturation of long-term potentiation,” Science, vol. 281, no. 5385, pp. 2038–2042, 1998.
View at: Publisher Site | Google Scholar
L. J. Lissner, K. M. Wartchow, A. P. Toniazzo, C. A. Gonçalves, and L. Rodrigues, “Object recognition and Morris water maze to detect cognitive impairment from mild hippocampal damage in rats: a reflection based on the literature and experience,” Pharmacology, Biochemistry, and Behavior, vol. 210, article 173273, 2021.
View at: Publisher Site | Google Scholar
K. Hernández-Mercado and A. Zepeda, “Morris water maze and contextual fear conditioning tasks to evaluate cognitive functions associated with adult hippocampal neurogenesis,” Frontiers in Neuroscience, vol. 15, article 782947, 2022.
View at: Publisher Site | Google Scholar
D. Brites and A. Fernandes, “Neuroinflammation and depression: microglia activation, extracellular microvesicles and microRNA dysregulation,” Frontiers in Cellular Neuroscience, vol. 9, p. 476, 2015.
View at: Publisher Site | Google Scholar
Y. Lee, S. Lee, J. W. Park et al., “Hypoxia-induced neuroinflammation and learning-memory impairments in adult zebrafish are suppressed by glucosamine,” Molecular Neurobiology, vol. 55, no. 11, pp. 8738–8753, 2018.
View at: Publisher Site | Google Scholar
R. J. Worthen, S. S. Garzon Zighelboim, C. S. Torres Jaramillo, and E. Beurel, “Anti-inflammatory IL-10 administration rescues depression-associated learning and memory deficits in mice,” Journal of Neuroinflammation, vol. 17, no. 1, p. 246, 2020.
View at: Publisher Site | Google Scholar
F. Gardoni, M. Boraso, E. Zianni et al., “Distribution of interleukin-1 receptor complex at the synaptic membrane driven by interleukin-1β and NMDA stimulation,” Journal of Neuroinflammation, vol. 8, no. 1, p. 14, 2011.
View at: Publisher Site | Google Scholar
V. Tancredi, M. D'Antuono, C. Cafè et al., “The inhibitory effects of interleukin-6 on synaptic plasticity in the rat hippocampus are associated with an inhibition of mitogen-activated protein kinase ERK,” Journal of Neurochemistry, vol. 75, no. 2, pp. 634–643, 2000.
View at: Publisher Site | Google Scholar
L. Ye, Y. Huang, L. Zhao et al., “IL-1β and TNF-α induce neurotoxicity through glutamate production: a potential role for neuronal glutaminase,” Journal of Neurochemistry, vol. 125, no. 6, pp. 897–908, 2013.
View at: Publisher Site | Google Scholar
M. N. Nenov, M. V. Konakov, I. Y. Teplov, and S. G. Levin, “Interleukin-10 facilitates glutamatergic synaptic transmission and homeostatic plasticity in cultured hippocampal neurons,” International Journal of Molecular Sciences, vol. 20, no. 13, p. 3375, 2019.
View at: Publisher Site | Google Scholar
H. A. Jurgens and R. W. Johnson, “Environmental enrichment attenuates hippocampal neuroinflammation and improves cognitive function during influenza infection,” Brain, Behavior, and Immunity, vol. 26, no. 6, pp. 1006–1016, 2012.
View at: Publisher Site | Google Scholar
G. Singhal, E. J. Jaehne, F. Corrigan, and B. T. Baune, “Cellular and molecular mechanisms of immunomodulation in the brain through environmental enrichment,” Frontiers in Cellular Neuroscience, vol. 8, p. 97, 2014.
View at: Publisher Site | Google Scholar
J. A. Schander, C. Marvaldi, F. Correa et al., “Maternal environmental enrichment modulates the immune response against an inflammatory challenge during gestation and protects the offspring,” Journal of Reproductive Immunology, vol. 144, article 103273, 2021.
View at: Publisher Site | Google Scholar
H. Eyre and B. T. Baune, “Neuroimmunological effects of physical exercise in depression,” Brain, Behavior, and Immunity, vol. 26, no. 2, pp. 251–266, 2012.
View at: Publisher Site | Google Scholar
H. A. Eyre, E. Papps, and B. T. Baune, “Treating depression and depression-like behavior with physical activity: an immune perspective,” Frontiers in Psychiatry, vol. 4, p. 3, 2013.
View at: Publisher Site | Google Scholar
T. T. Huang, D. Leu, and Y. Zou, “Oxidative stress and redox regulation on hippocampal-dependent cognitive functions,” Archives of Biochemistry and Biophysics, vol. 576, pp. 2–7, 2015.
View at: Publisher Site | Google Scholar
A. Kandlur, K. Satyamoorthy, and G. Gangadharan, “Oxidative stress in cognitive and epigenetic aging: a retrospective glance,” Frontiers in Molecular Neuroscience, vol. 13, p. 41, 2020.
View at: Publisher Site | Google Scholar
A. Singh, S. Dhaneshwar, and A. Mazumder, “Investigating Neuroprotective Potential of Berberine, Levetiracetam and Their Combination in The Management of Alzheimer's Disease Utilizing Drug Repurposing Strategy,” Current Reviews in Clinical and Experimental Pharmacology, vol. 16, 2021.
View at: Publisher Site | Google Scholar
M. Aghsami, M. Sharifzadeh, M. R. Sepand, M. Yazdankhah, S. A. Seyednejad, and J. Pourahmad, “A cAMP analog attenuates beta-amyloid (1-42)-induced mitochondrial dysfunction and spatial learning and memory deficits,” Brain Research Bulletin, vol. 140, pp. 34–42, 2018.
View at: Publisher Site | Google Scholar
H. Zhu, T. Zhao, and J. Liu, “Role of paraoxonase 1 activity and oxidative/antioxidative stress markers in patients with acute cerebral infarction,” Clinical Laboratory, vol. 64, no. 6, pp. 1049–1053, 2018.
View at: Publisher Site | Google Scholar
J. Park, J. S. Min, B. Kim et al., “Mitochondrial ROS govern the LPS-induced pro-inflammatory response in microglia cells by regulating MAPK and NF-κB pathways,” Neuroscience Letters, vol. 584, pp. 191–196, 2015.
View at: Publisher Site | Google Scholar
B. Liu, W. Liu, P. Liu et al., “Silibinin alleviates the learning and memory defects in overtrained rats accompanying reduced neuronal apoptosis and senescence,” Neurochemical Research, vol. 44, no. 8, pp. 1818–1829, 2019.
View at: Publisher Site | Google Scholar
W. Liu, X. Tan, X. Xiong, J. Yang, and X. Xiao, “Effects of hypothermia during propofol anesthesia on learning and memory ability and hippocampal apoptosis in neonatal rats,” Journal of Anesthesia, vol. 33, no. 1, pp. 9–16, 2019.
View at: Publisher Site | Google Scholar
K. W. Nkpaa, B. A. Amadi, M. O. Wegwu, and E. O. Farombi, “Ethanol increases manganese--induced spatial learning and memory deficits _via_ oxidative/nitrosative stress induced p53 dependent/independent hippocampal apoptosis,” Toxicology, vol. 418, pp. 51–61, 2019.
View at: Publisher Site | Google Scholar
E. Wawryk-Gawda, P. Chylińska-Wrzos, M. Lis-Sochocka et al., “P53 protein in proliferation, repair and apoptosis of cells,” Protoplasma, vol. 251, no. 3, pp. 525–533, 2014.
View at: Publisher Site | Google Scholar
A. Rufini, P. Tucci, I. Celardo, and G. Melino, “Senescence and aging: the critical roles of p53,” Oncogene, vol. 32, no. 43, pp. 5129–5143, 2013.
View at: Publisher Site | Google Scholar
K. H. Vousden and D. P. Lane, “p53 in health and disease,” Nature Reviews. Molecular Cell Biology, vol. 8, no. 4, pp. 275–283, 2007.
View at: Publisher Site | Google Scholar
A. Ashkenazi, W. J. Fairbrother, J. D. Leverson, and A. J. Souers, “From basic apoptosis discoveries to advanced selective BCL-2 family inhibitors,” Nature Reviews. Drug Discovery, vol. 16, no. 4, pp. 273–284, 2017.
View at: Publisher Site | Google Scholar
H. Yan, W. Huang, J. Rao, and J. Yuan, “miR-21 regulates ischemic neuronal injury via the p53/Bcl-2/Bax signaling pathway,” Aging (Albany NY), vol. 13, no. 18, pp. 22242–22255, 2021.
View at: Publisher Site | Google Scholar
S. E. Choi, Y. S. Park, and H. C. Koh, “NF-κB/p53-activated inflammatory response involves in diquat-induced mitochondrial dysfunction and apoptosis,” Environmental Toxicology, vol. 33, no. 10, pp. 1005–1018, 2018.
View at: Publisher Site | Google Scholar
M. Long, Z. Wang, L. Shao, J. Bi, Z. Chen, and N. Yin, “Electroacupuncture pretreatment attenuates cerebral ischemia-reperfusion injury in rats through transient receptor potential vanilloid 1-mediated anti- apoptosis via inhibiting NF-κB signaling pathway,” Neuroscience, vol. 482, pp. 100–115, 2022.
View at: Publisher Site | Google Scholar
A. Keymoradzadeh, C. M. Hedayati, M. Abedinzade, R. Gazor, M. Rostampour, and B. K. Taleghani, “Enriched environment effect on lipopolysaccharide-induced spatial learning, memory impairment and hippocampal inflammatory cytokine levels in male rats,” Behavioural Brain Research, vol. 394, article 112814, 2020.
View at: Publisher Site | Google Scholar
M. H. Ji, H. Tang, D. Luo et al., “Environmental conditions differentially affect neurobehavioral outcomes in a mouse model of sepsis-associated encephalopathy,” Oncotarget, vol. 8, no. 47, pp. 82376–82389, 2017.
View at: Publisher Site | Google Scholar
M. G. Prado Lima, H. L. Schimidt, A. Garcia et al., “Environmental enrichment and exercise are better than social enrichment to reduce memory deficits in amyloid beta neurotoxicity,” Proceedings of the National Academy of Sciences of the United States of America, vol. 115, no. 10, pp. E2403–E 2409, 2018.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2022 Shan Jiang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies