Research Article
Interaction Effects of Season of Birth and Cytokine Genes on Schizotypal Traits in the General Population
Table 2
Genotyping conditions for the IL1B rs16944, IL4 rs2243250, and IL-1RN VNTR polymorphisms.
| Polymorphism | Primer | PCR reaction mixture and program | Restriction endonuclease | PCR or digestion products |
| IL1B rs16944 | Forward 5′TGGCATTGATCTGGTTCATC3′ reverse 5′GTTTAGGAATCTTCCCACTT3′ | 94°C/2 min 30 cycles: 94°C/20 s 50°C/20 s 72°C/20 s 72°C/4 min | Ama87I (SybEnzym, Russia) | Digested C allele, 190 + 115 bp, nondigested T allele, 305 bp |
| IL4 rs2243250 | Forward 5′ACTAGGCCTCACCTGATACG3′ reverse 5′GTTGTAATGCAGTCCTCCTG3′ | 94°C/2 min 30 cycles: 94°C/30 s 50°C/30 s 72°C/30 s 72°C/4 min | BslFI (SybEnzym, Russia) | Digested C allele, 177 + 18 bp, nondigested T allele, 195 bp |
| IL-1RN VNTR | Forward 5′-CTCAGCAACACTCCTAT-3′ reverse 5′-TCCTGGTCTGCAGGTAA3′ | 94°C/2 min 30 cycles: 94°C/20 s 50°C/20 s 72°C/20 s 72°C/4 min | - | Allele 1, 412 bp, allele 2, 240 bp, allele 3, 498 bp, allele 4, 326 bp, allele 5, 584 bp |
|
|