Research Article
Occurrence of Virulence Genes and Antimicrobial Resistance of E. coli O157:H7 Isolated from the Beef Carcass of Bahir Dar City, Ethiopia
Table 1
Sequence of primers, their product size, and their annealing temperature.
| | Gene | Primer | Sequence (5′-3′) | Primer length (bp) | Annealing temperature (°C) | Reference |
| | stx1 | EVS-1 | F: ATCAGTCGTCACTCACTGG | 110 | 55 | [38] | | EVC-2 | R: CTGCTGTCACAGTGACAAA | | stx2 | EVT-1 | F: CAACACTGGATGATCTCAG | 350 | 55 | [38] | | EVT-2 | R: CCCCCTCAACTGCTAATA | | hlyA | Hly-1 | F: GGTGCAGCAGAAAAAGTTG | 165 | 45 | [39] | | Hly-1 | R: CCACGTCGTCTTTTTCAACA | | eae | EAE-1 | F: AAACAGGTGAAACTGTTGCC | 490 | 55 | [20] | | EAE-2 | R: CTCTGCAGATTAACCTCTGC |
|
|
EAE: effacing and attaching; EV: verocytotoxin; stx: Shiga toxin; bp: base pair; F: forward primer; R: reverse primer; hlyA: hemolysin.
|
