Abstract
Background. T-cell cytokine gene polymorphisms and vitamin D pathway gene polymorphisms were evaluated as possibly associated with end-stage renal disease (ESRD) resulting from type 2 diabetes mellitus (DM) nephropathy. Methods. Studies were conducted among hemodialysis (HD) patients with ESRD due to type 2 DM nephropathy, chronic glomerulonephritis, chronic infective tubulointerstitial nephritis, and hypertensive nephropathy as well as in healthy subjects. A frequency distribution of T-cell-related interleukin (IL) genes (IL18 rs360719, IL12A rs568408, IL12B rs3212227, IL4R rs1805015, IL13 rs20541, IL28B rs8099917, IL28B, and rs12979860) and vitamin D pathway genes (GC genes: rs2298849, rs7041, and rs1155563; VDR genes: rs2228570, rs1544410; and RXRA genes: rs10776909, rs10881578, and rs749759) was compared between groups. Results. No significant differences in a frequency distribution of tested polymorphisms were shown between type 2 DM nephropathy patients and controls. A difference was found in IL18 rs360719 polymorphic distribution between the former group and chronic infective tubulointerstitial nephritic patients (), which also differed in this polymorphism from controls (). Conclusion. T-cell cytokine and vitamin D pathway gene polymorphisms are not associated with ESRD due to type 2 DM nephropathy in Polish HD patients. IL18 rs360719 is probably associated with the pathogenesis of chronic infective tubulointerstitial nephritis.
1. Introduction
Diabetes mellitus (DM) is the most common cause of end-stage renal disease (ESRD) in many hemodialysis (HD) centers. In Australia and New Zealand, the incident ESRD population (1991–2005) who began renal replacement therapy (RRT) included 30.0% type 2 DM and 4.5% type 1 DM subjects [1]. In the HEMODIALYSIS (HEMO) study, the group of HD patients comprised approximately 45% of DM subjects [2].
Diabetic ESRD patients compared to nondiabetic ESRD subjects show higher both mortality rate [3] and prevalence of coronary artery disease (CAD) [4], are more prone to severe infections [5] and worse response to hepatitis B vaccination [6], and more often suffer from adynamic bone disease associated with low serum parathyroid hormone (PTH) levels [7]. In this paper we will focus on ESRD due to type 2 DM nephropathy. Together with altered glucose metabolism and insulin resistance, deficiency of vitamin D [8] and aberrant T-cell cytokine balance [9] were found to be associated with this severe complication of type 2 DM. There is a link between vitamin D and T-cell functional balance: active form of vitamin D [1,25(OH)2D] has the inhibitory effect on the T helper (Th) 17 and Th1 response [10].
Abnormalities in T-cell cytokine equilibrium [11–13] and plasma vitamin D concentrations [14–16] are related to cardiovascular events [13, 16] and immunononcompetence during infections [11, 14] and vaccinations [12, 15]. Serum PTH levels are dependent on serum vitamin D concentrations [17], and T cells are implicated in the mechanism of PTH action in bone [18].
Vitamin D activity may be adequately expressed if vitamin D pathway components (vitamin D binding protein, also referred to as group-specific component (GC), vitamin D receptor (VDR), and retinoid X receptors (RXRs)) are properly structured and regulated. The recent study by Zhang et al. [19] has shown that VDR BsmI polymorphism correlates with type 2 DM nephropathy and may be susceptible for early onset of this nephropathy. Among T-cell-related cytokine gene polymorphisms, promoter polymorphic variants of IL10 [20, 21] and IL6 [22] were already associated with the risk of type 2 DM nephropathy. Monocyte chemoattractant protein 1 (MCP-1) has been reported to participate in the pathogenesis of early type 2 DM nephropathy [23], but MCP1 polymorphism in the promoter region was not differentially distributed between ESRD patients with type 2 DM nephropathy and healthy controls [24, 25].
To our knowledge, there are scarce data, if any, on ESRD due to type 2 DM nephropathy showing a frequency distribution of single nucleotide polymorphisms (SNPs) of T-cell-related IL genes: IL18 rs360719, IL12A rs568408, IL12B rs3212227, IL4R rs1805015, IL13 rs20541, IL28B rs8099917, and IL28B rs12979860 as well as vitamin D pathway genes: GC genes (GC rs2298849, rs7041, and rs1155563), VDR genes (VDR rs2228570, rs1544410), and RXR α genes (RXRA rs10776909, rs10881578, and rs749759). The aim of our study was to determine the potential association between aforementioned polymorphisms of T-cell-related cytokine genes and vitamin D pathway genes and ESRD due to type 2 DM nephropathy. For comparisons, aforementioned genotype frequencies of healthy controls as well as ESRD patients with other main causes of ESRD were used. Polymorphism related associations, if exist, could contribute to explanation of susceptibility to ESRD due to type 2 DM nephropathy and phenotype differences between ESRD patients with type 2 DM nephropathy and other causes of ESRD.
2. Material and Methods
2.1. Patients and Controls
Blood samples for genotype analyses are collected since 2009 from ESRD patients (estimated glomerular filtration rate (eGFR) category G5 in accordance with KDIGO recommendations [26]). All subjects were treated with HD on enrolment. Controls were recruited from blood donors and healthy volunteers unrelated to patients. All enrolled individuals live/lived in the Greater Poland region of Poland.
Genotyping of IL18 rs360719, IL12A rs568408, IL12B rs3212227, IL4R rs1805015, and IL13 rs20541 polymorphisms was performed in 2009–2012 using currently available material. Results had been analyzed in our previous studies in the context of responsiveness to the surface antigen of hepatitis B virus (HBsAg) using data of all (not segregated) patients [27–30]. For this study, we used results of controls and patients with type 2 DM nephropathy, chronic glomerulonephritis, chronic infective tubulointerstitial nephritis, and hypertensive nephropathy.
IL28B rs8099917, IL28B rs12979860, GC rs2298849, GC rs7041, GC rs1155563, VDR rs2228570, VDR rs1544410, RXRA rs10776909, RXRA rs10881578, and RXRA rs749759 polymorphisms were analyzed in winter 2013/2014 among HD patients with ESRD () due to type 2 DM nephropathy (), chronic glomerulonephritis (), chronic infective tubulointerstitial nephritis (), and hypertensive nephropathy () as well as healthy controls ().
DM was not diagnosed in patients having renal diseases other than type 2 DM nephropathy.
Healthy individuals and HD patients with other renal diseases as cause of ESRD served as reference groups for a frequency distribution of tested polymorphic variants. All examined subjects were of Caucasian race.
Basic clinical and laboratory data were collected on enrolment and they are updated every year.
2.2. Genotyping
Genomic DNA for genotype analysis was isolated from peripheral blood lymphocytes by salt-out extraction procedure.
Genotyping of IL18 rs360719, IL12A rs568408, IL12B rs3212227, IL4R rs1805015, and IL13 rs20541 polymorphisms was performed as previously described [27–30].
IL28B rs8099917 and IL28B rs12979860 polymorphisms were genotyped using high-resolution melting curve analysis (HRM) on the LightCycler 480 system (Roche Diagnostics, Mannheim, Germany) with the use of 5x HOT FIREPol EvaGreen HRM Mix (Solis BioDyne, Tartu, Estonia). The PCR program consisted of an initial step at 95°C for 15 min to activate HOT FIREPol DNA polymerase, followed by 50 amplification cycles of denaturation at 95°C for 10 s, annealing at 61°C for 10 s, and elongation at 72°C for 15 s. Amplified DNA fragments were then subjected to HRM with 0.1°C increments in temperatures ranging from 76 to 96°C. Primers used for PCR with subsequent HRM analysis were as follows: rs8099917F 5′TTTGTCACTGTTCCTCCTTTTG3′, rs8099917R 5′AAGACATAAAAAGCCAGCTACCA3′, rs12979860F 5′CGTGCCTGTCGTGTACTGAA3′, and rs12979860R 5′AGGCTCAGGGTCAATCACAG3′.
Genotyping of the GC rs1155563, GC rs2298849, RXRA rs10881578, and RXRA rs10776909 polymorphisms was carried out by HRM on the Bio-Rad CFX96 Real Time PCR system (Bio-Rad, Hercules, CA). DNA fragments amplified with the use of specific primers were subjected to HRM with 0.1°C increments in temperatures ranging from 71 to 92°C. Genotyping of the GC rs7041, RXRA rs749759, VDR rs1544410, and VDR rs2228570 was performed using the polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) method according to the manufacturer’s instructions (Fermentas, Vilnius, Lithuania). Primer sequences and conditions for HRM and PCR-RFLP analyses are presented in Table 1.
For quality control, the genotyping analysis was blinded to the subject’s case-control status. In addition, approximately 10% of the randomly chosen samples were regenotyped. Samples that failed the genotyping were excluded from further statistical analyses.
2.3. 25(OH)D Testing
Plasma 25(OH)D was determined in blindly selected 162 HD patients in the winter season of the year to avoid differences in sunlight exposure between patients who used to sunbathe and those who did not. Plasma 25(OH)D concentration was measured in HD patients who had not been treated with vitamin D or had stopped such a treatment for at least 3 weeks to obtain the so-called basic vitamin D concentrations. Under these conditions, there were no patients showing optimal plasma 25(OH)D levels (35–80 ng/mL for adults). To examine plasma 25(OH)D levels, a chemiluminescent microparticle immunoassay (CMIA) was used according to the manufacturer’s instructions (Abbott Diagnostics ARCHITECT 25-OH VITAMIN D CMIA).
2.4. Statistical Methods
Results are presented as percentage for categorical variables, as mean with one standard deviation for normally distributed continuous variables or as median with range for not normally distributed continuous variables as tested by the Shapiro-Wilk test. Statistical tests used for comparison of data obtained in selected groups are indicated at values.
Hardy-Weinberg equilibrium (HWE) was tested to compare the observed genotype frequencies to the expected ones using Chi-square test. Distributions of tested polymorphisms were consistent with HWE with three exceptions which are indicated in tables showing analysis of genotype and allele distributions. The Fisher exact probability test or Chi-square test was used to evaluate differences in genotype and allele prevalence between the examined groups. Homozygotes for the major allele were the reference group. The odds ratio (OR) with value and 95% confidence intervals (95% CI) value were calculated. All probabilities were two-tailed. Polymorphisms were tested for association using the Chi-square test for trend (). Power analysis was performed by Fisher’s exact test.
Values of were judged to be significant. However, associations were reported only if the following conditions were fulfilled.(1)A genotype distribution was consistent with HWE in a tested group and a referent group.(2) was below 0.05.(3)Odds ratio remained significant after the Bonferroni correction applied for multiple testing, if appropriate.
Aforementioned statistical calculations were performed using GraphPad InStat 3.10, 32 bit for Windows, created on July 9, 2009 (GraphPad Software, Inc., La Jolla, USA), CytelStudio version 10.0, created on January 16, 2013 (CytelStudio Software Corporation, Cambridge, USA), and Statistica version 10, 2011 (StatSoft, Inc., Tulsa, USA).
3. Results
Characteristics of the examined HD patients are presented in Tables 2 and 3. ESRD patients due to type 2 DM nephropathy compared to non-DM ESRD patients showed older age at RRT onset, shorter treatment with RRT, higher death rate on RRT, higher prevalence of CAD and myocardial infarction, lower serum PTH level, and lower frequency of parathyroidectomy and treatment with cinacalcet.
In respect of the examined parameters, type 2 DM nephropathy patients differed the most significantly from chronic glomerulonephritic subjects, the least significantly from hypertensive nephropathy patients.
There were no differences in frequency distributions of tested genotypes between type 2 DM nephropathy patients and healthy subjects (Table 4) as well as other ESRD patients analyzed together (Table 5) which could be judged as significant associations.
Comparisons of genotype and allele frequencies between type 2 DM nephropathy patients and other ESRD groups revealed associations only with chronic infective tubulointerstitial nephritic patients in respect of IL18 rs360719 (Table 6, no significant results are shown). Frequency of IL18 rs360719 allele C carriers was higher in type 2 DM nephropathy patients than in those with chronic infective tubulointerstitial nephritis. The latter group showed lower frequency of IL18 rs360719 allele C carriers compared to healthy controls (Table 6).
Type 2 DM nephropathy patients with diagnosed CAD differed in tested genotype frequencies neither from type 2 DM nephropathy subjects without CAD (Table 7) nor from healthy controls (Table 8).
4. Discussion
Genetic studies involving DM nephropathy and related complications are not consistent in many aspects [31–34]. Some polymorphisms tested in this study were reported as being associated with type 1 DM (IL12B rs3212227 [35], IL4R [36, 37], IL13 [37], VDR rs1544410 [38, 39], and VDR rs2228570 [38]), type 2 DM susceptibility (VDR rs2228570 [40], VDR rs1544410 [41]), and phenotype of type 2 DM (VDR rs2228570 [42], VDR rs1544410 [41, 43]). VDR rs2228570 and IL4 polymorphisms were also related to the risk of chronic kidney disease [44, 45]. On the other hand, there are also data indicating no major effect of IL12B on type 1 DM susceptibility in the entire study group [46], no association of IL4R with type 1 DM [47], no evident causal relationship between vitamin D pathway genes and type 2 DM, myocardial infarction or mortality [48], similar distribution of genotypes, allele and haplotypes of VDR rs2228570 and VDR rs731236 between type 2 DM patients and controls [49], no contribution of VDR rs1544410 to type 1 DM susceptibility [50], and no association of VDR rs1544410 with chronic kidney disease susceptibility [51].
In this study we were not able to show significant differences in the frequency distribution of tested polymorphic variants of T-cell-related cytokine genes or vitamin D pathway genes between HD patients with ESRD due to type 2 DM nephropathy and controls as well as HD patients with other causes of ESRD analyzed together. This lack of association was present although the examined type 2 DM nephropathy patients showed clinical complications more frequently than HD patients with other renal diseases: higher dialysis related mortality rate [3], higher prevalence of CAD including myocardial infarction [4], lower serum PTH, and lower frequency of parathyroidectomy and treatment with cinacalcet, all of them predictive for higher tendency to adynamic bone disease [7]. Type 2 DM nephropathy patients with or without diagnosis of CAD also did not differ in tested genotype distributions.
Development of ESRD substantially ameliorates interpatient clinical variability related to underlying renal impairment and exposes uremia-related signs and symptoms. Comparisons of type 2 DM nephropathy patients in respect of tested genotype frequencies with subjects showing other common causes of ESRD revealed that the former group has a higher IL18 rs360719 minor allele frequency than chronic infective tubulointerstitial nephritic group. In this case, lower IL18 rs360719 minor allele frequency in tubulointerstitial nephritic patients was observed also when their results were compared to those of healthy subjects. Sánchez et al. [52] have found a significant increase in the relative expression of IL-18 mRNA in individuals carrying the rs360719 minor allele. IL-18 is IFN-γ inducing factor. Infective tubulointerstitial nephritic patients are known to have diminished ability of blood leukocytes to produce IFN-γ [53]. Our study indicates that this may be related to lower frequency of IL18 rs360719 minor allele in this group compared to controls and type 2 DM nephropathy patients. In type 2 DM patients with overt nephropathy, positive correlations between plasma IFN-γ, proteinuria, and eGFR were found [54].
Due to limited financial support, we did not perform any functional studies regarding T-cell-related interleukin and vitamin D pathway genes, especially that multiple influences independent or dependent on genetic profile need to be taken into account in such studies conducted in the uremic milieu. Although the examined patients showing ESRD due to type 2 DM nephropathy were well-defined group, they obviously were not consistent in HLA DRB1 alleles. The latter could be important in modulating susceptibility to advanced type 2 DM nephropathy and related complications, like it was shown for type 1 DM [55] or type 2 DM [41], regardless of their complications.
5. Summary
Distributions of tested T-cell cytokine gene polymorphisms or vitamin D pathway gene polymorphisms are not significantly different among patients with ESRD due to type 2 DM nephropathy and healthy individuals. Subjects with ESRD due to type 2 DM nephropathy differ in clinical manifestation from patients with other nephropathies leading to dialysis dependency, but differences in tested genotype distributions were found only in IL18 rs360719 compared with chronic tubulointerstitial nephritic patients. This difference probably arose from the fact that pathology of chronic infective tubulointerstitial nephritis might have been associated with this specific polymorphism.
6. Conclusions
In Polish HD patients, T-cell cytokine gene polymorphisms and vitamin D pathway gene polymorphisms are not associated with ESRD due to type 2 DM nephropathy. IL18 polymorphism is worthy to be further investigated in chronic infective tubulointerstitial nephritic patients as being possibly associated with this disease.
Conflict of Interests
The authors declare that there is no conflict of interests regarding the publication of this paper.