Research Article
[Retracted] Expression and Relationship of Netrin-1, DCC, UNC5B, and VEGF in Villous Tissues of Patients with Delayed Abortion
Table 2
Primers of the target gene and reference gene.
| Primer name | Base sequence (5′-3′) | Product length |
| GAPDH | | 259 | head waters | CATCATCCCTGCCTCTACTGG | | lower reaches | GTGGGTGTCGCTGTTGAAGTC | |
| Netrin-1 | | 197 | head waters | ACTGCCATTACTGCAAGGAGG | | lower reaches | GCTCTGCTGGTAGCCTTTGG | |
| DCC | | 146 | head waters | AGCCGATTTGTCCGTCTCAG | | lower reaches | CCCACAGTGAGCTGAAGGGA | |
| UNC5B | | 194 | head waters | GGTCTACTGCCTGGAGGACAC | | lower reaches | GGATCTCCTGGTATTTGGC | |
| VEGF | | 155 | head waters | GAACTTTCTGCTGTCTTGGGTG | | lower reaches | GGCAGTAGCTGCGCTGATAG | |
|
|