Prevalence and Phenotypic and Genotypic Patterns of Antibiotic Resistance of Acinetobacter baumannii Strains Isolated from Fish, Shrimp, and Lobster Samples
Table 1
Conditions used for the PCR-based detection of antibiotic resistance genes in the A. baumannii isolates [23–26].
Target gene
Primer (5-3)
Size (bp)
PCR cycles
PCR volume
aadA1
(F) TATCCAGCTAAGCGCGAACT (R) ATTTGCCGACTACCTTGGTC
447
1 cycle: 94°C for 6 min 33 cycles: 95°C for 70 s, 55°C for 65 s, and 72°C for 90 s 1 cycle: 72°C for 8 min
5 μL of PCR buffer 10x 2 mM of Mgcl2 150 μM of dNTP 1 μM of each primer (F and R) 1 U of Taq DNA polymerase 3 μL of DNA template