Research Article
Associations of Functional MicroRNA Binding Site Polymorphisms in IL23/Th17 Inflammatory Pathway Genes with Gastric Cancer Risk
Table 2
PCR information and restriction enzymes used for genotyping of the four miRNA binding site SNPs.
| | Gene | SNP ID | Alleles | Annealing Tm (°C) | Restriction enzyme | Genotype (bp) | Primers |
| | IL17A | rs3748067 | C/T | 58.2 | ApoI | C: 317 | Sense AGGATGGAGTGAAGAGGAA | | | | | | | T: 202,115 | Antisense AGAGATCAACAGACCAACAT | | IL23R | rs10889677 | A/C | 56.6 | MnlI | A: 165 | Sense TGCTCCTACCATCACCAT | | | | | | | C: 86,79 | Antisense TGAGGCGTCCACATAATG | | IL17RA | rs1468488 | T/C | 59.6 | AluI | T: 164,94,92 | Sense GGAGGAAGAGGAGGAAGAG | | | | | | | C: 256,94 | Antisense GGATAGACGATAACCAGACC | | IL17RA | rs887796 | A/G | 56.6 | BanI | A: 454 | Sense AATTCTCCAAGGTGTCTGTT | | | | | | | G: 263,191 | Antisense GATCAAGATAGTAGGCAGGAA |
|
|
SNP: single-nucleotide polymorphism.
|